Deep sequencing reads for mature sequence MIMAT0000703

Stem-loop ID hsa-mir-361
Mature ID hsa-miR-361-5p
Reads
     hsa-miR-361-5p                         hsa-miR-361-3p                Count     RPM (mean number of reads per million)
....CUUAUCAGAAUCUCCAGGGGUAC.............................................  2         0.0314
....CUUAUCAGAAUCUCCAGGGGUA..............................................  2         0.0314
.....UUAUCAGAAUCUCCAGGGGUAC.............................................  2174      174
.....UUAUCAGAAUCUCCAGGGGUA..............................................  345       7.99
.....UUAUCAGAAUCUCCAGGGGU...............................................  169       117
.....UUAUCAGAAUCUCCAGGGGUACU............................................  158       7.65
.....UUAUCAGAAUCUCCAGGGG................................................  10        0.178
.....UUAUCAGAAUCUCCAGGGGUACUU...........................................  7         0.145
.....UUAUCAGAAUCUCCAGGGGUACUUU..........................................  2         0.0314
......UAUCAGAAUCUCCAGGGGUAC.............................................  5         0.112
......UAUCAGAAUCUCCAGGGGUACU............................................  5         0.114
......UAUCAGAAUCUCCAGGGGU...............................................  1         2.37
..........AGAAUCUCCAGGGGUAC.............................................  2         0.0314
.......................................AAAAGUCCCCCAGGUGUGAUUCU..........  1         6.9
..........................................AGUCCCCCAGGUGUGAUUCUGA........  2         0.0314
............................................UCCCCCAGGUGUGAUUCUGAUUU.....  75        1.68
............................................UCCCCCAGGUGUGAUUCUGAUUUG....  63        1.94
............................................UCCCCCAGGUGUGAUUCUGAUU......  21        0.964
............................................UCCCCCAGGUGUGAUUCUGAU.......  13        26.1
............................................UCCCCCAGGUGUGAUUCUGAUUUGC...  7         0.563
............................................UCCCCCAGGUGUGAUUCUGA........  2         0.081
.............................................CCCCCAGGUGUGAUUCUGAUUUGC...  29        5.18
.............................................CCCCCAGGUGUGAUUCUGAUUUG....  9         1.79
..............................................CCCCAGGUGUGAUUCUGAUUUGC...  1         0.15
...............................................CCCAGGUGUGAUUCUGAUUU.....  1         3.84
GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUUCUGAUUUGCUUC
(((((..(((((((((.((.((((.(((((..........))))).)))).))...)))))))))..))))) (-32.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 8embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 75embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 174melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 35melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 180 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 64melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 138melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 1454melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 187melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 422melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 450melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 522melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 194melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 256melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000137 1 GEO : GSM532873 normal cervix [ Witten D et al.]
ER0000000143 5 GEO : GSM532879 normal cervix [ Witten D et al.]
ER0000000149 5 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000155 17 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 48 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 39 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 32 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 26 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000176 3adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 47 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 18 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000182 1squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000185 11 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 3 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000262 46 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 70 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 40 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 2 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000267 4 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4