Deep sequencing reads for mature sequence MIMAT0000688

Stem-loop ID hsa-mir-301a
Mature ID hsa-miR-301a-3p
Reads 
            hsa-miR-301a-5p                      hsa-miR-301a-3p                        Count     RPM (mean number of reads per million)
.............GCUCUGACUUUAUUGCACUACU...................................................  733       20.3
.............GCUCUGACUUUAUUGCACUAC....................................................  138       3.79
.............GCUCUGACUUUAUUGCACUA.....................................................  15        0.49
.............GCUCUGACUUUAUUGCACU......................................................  6         0.151
.............GCUCUGACUUUAUUGCAC.......................................................  3         0.0857
.............GCUCUGACUUUAUUGCACUACUG..................................................  2         0.0544
..............CUCUGACUUUAUUGCACUACU...................................................  8         0.223
.................................................GCAGUGCAAUAGUAUUGUCAAAGC.............  2         0.632
..................................................CAGUGCAAUAGUAUUGUCAAAGCAU...........  136       11.5
..................................................CAGUGCAAUAGUAUUGUCAAAGCA............  61        2.33
..................................................CAGUGCAAUAGUAUUGUCAAAGC.............  60        73.1
..................................................CAGUGCAAUAGUAUUGUCAAAG..............  11        8.24
..................................................CAGUGCAAUAGUAUUGUC..................  4         11.8
..................................................CAGUGCAAUAGUAUUGUCA.................  4         0.123
...................................................AGUGCAAUAGUAUUGUCAAAGCAU...........  2         0.0571
...................................................AGUGCAAUAGUAUUGUCAAAGC.............  1         2.64
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG
.(((((..((.(((((.((((.((((((((((.(((((...))))).....))))))))))....)))).))))).))..))))). (-32.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 12embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 56embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 74melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 29melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 48 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 19melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 65melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 74melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 355melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 272melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 35melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 72melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 98melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 102melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000155 2 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 2 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 1 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 1 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 4 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 1 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 1 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 1 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000262 2 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 6 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 4 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 1 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).