Deep sequencing reads for mature sequence MIMAT0000457

Stem-loop ID

hsa-mir-188

Mature ID

hsa-miR-188-5p

Reads

             hsa-miR-188-5p                         hsa-miR-188-3p                      Count     RPM (mean number of reads per million)
..............CAUCCCUUGCAUGGUGGAGGGU..................................................  150       5.29
..............CAUCCCUUGCAUGGUGGAGGG...................................................  25        1.49
..............CAUCCCUUGCAUGGUGGAGG....................................................  11        1.06
..............CAUCCCUUGCAUGGUGGAG.....................................................  5         0.842
..............CAUCCCUUGCAUGGUGGA......................................................  1         27.2
..................................................CCCCUCCCACAUGCAGGGUUUGCA............  27        224
..................................................CCCCUCCCACAUGCAGGGUUUGC.............  10        80.6
....................................................CCUCCCACAUGCAGGGUUUGCA............  2         0.77
.....................................................CUCCCACAUGCAGGGUUUGCA............  10        1.76
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGCGAGCC
.((((((..(((..((..(((((((((..((((((....(.....).....))))))..)))))))))..))..))).)).)))). (-39.80)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000002	20	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000103	34	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	2	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	7		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	4	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	22	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	257	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	10	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	66	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	87	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	86	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	52	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	43	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000147	4		GEO : GSM532883	normal cervix	[ Witten D et al.]
ER0000000157	8		GEO : GSM532893	normal cervix	[ Witten D et al.]
ER0000000161	12		GEO : GSM532897	normal cervix	[ Witten D et al.]
ER0000000165	13		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000171	15		GEO : GSM532907	normal cervix	[ Witten D et al.]
ER0000000174	1	squamous cell	GEO : GSM532910		[ Witten D et al.]
ER0000000181	5		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000183	2	whole body	GEO : GSM532919	normal cervix	[ Witten D et al.]
ER0000000193	1		GEO : GSM532929	normal cervix	[ Witten D et al.]
ER0000000263	1		GEO : GSM337571	antibody: anti-Ago2 11A9

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).