Deep sequencing reads for mature sequence MIMAT0000452

Stem-loop ID hsa-mir-154
Mature ID hsa-miR-154-5p
Reads 
              hsa-miR-154-5p                      hsa-miR-154-3p                       Count     RPM (mean number of reads per million)
..............UAGGUUAUCCGUGUUGCCUUCG................................................  32        2.83
..............UAGGUUAUCCGUGUUGCCU...................................................  2         0.0655
..................................................AAUCAUACACGGUUGACCUAUU............  64        2.1
..................................................AAUCAUACACGGUUGACCUAU.............  7         0.229
..................................................AAUCAUACACGGUUGACCUAUUU...........  2         0.0655
GUGGUACUUGAAGAUAGGUUAUCCGUGUUGCCUUCGCUUUAUUUGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAA
.(((((((.((((((((((((.((((((....(((((.........).))))....)))))).)))))))))))).))))))). (-37.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 4embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000105 105 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000149 1 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000159 40 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000163 14 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000167 15 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000173 19 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000177 32 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 6 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000185 2 GEO : GSM532921 normal cervix [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).