Deep sequencing reads for mature sequence MIMAT0000451

Stem-loop ID hsa-mir-150
Mature ID hsa-miR-150-5p
Reads 
               hsa-miR-150-5p                     hsa-miR-150-3p                       Count     RPM (mean number of reads per million)
..........CCCUGUCUCCCAACCCUUGUACCAGU................................................  2         20.8
...............UCUCCCAACCCUUGUACCAGUG...............................................  30        303
...............UCUCCCAACCCUUGUACCAGU................................................  4         46.8
...............UCUCCCAACCCUUGUACCAG.................................................  1         4.36
..................CCCAACCCUUGUACCAGU................................................  7         169
..................CCCAACCCUUGUACCAGUG...............................................  7         220
..................CCCAACCCUUGUACCAGUGC..............................................  1         18.3
..................................................CUGGUACAGGCCUGGGGG................  1         52.1
CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACCUGGGGAC
.((((((.((((((((((((((..(((.(((((((.((((....))).).))))))))))..)))))))))))).)))))))). (-57.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000136 1squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000140 1squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 1 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000142 1squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000161 2 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 6 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 5 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 6 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000175 3 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000176 5adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000181 2 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000182 1squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000183 1whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000264 34 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000266 7 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 4 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).