Deep sequencing reads for mature sequence MIMAT0000423

Stem-loop ID hsa-mir-125b-1
Mature ID hsa-miR-125b-5p
Reads 
             hsa-miR-125b-5p                       hsa-miR-125b-1-3p                       Count     RPM (mean number of reads per million)
..............UCCCUGAGACCCUAACUUGUGA....................................................  9249      307
..............UCCCUGAGACCCUAACUUGUG.....................................................  504       529
..............UCCCUGAGACCCUAACUUGU......................................................  125       56
..............UCCCUGAGACCCUAACUUGUGAU...................................................  57        0.641
..............UCCCUGAGACCCUAACUUG.......................................................  18        59.2
..............UCCCUGAGACCCUAACUU........................................................  6         16.9
..............UCCCUGAGACCCUAACU.........................................................  4         0.0389
...............CCCUGAGACCCUAACUUGUGA....................................................  62        455
...............CCCUGAGACCCUAACUUGUG.....................................................  24        136
...............CCCUGAGACCCUAACUUGU......................................................  10        52.8
...............CCCUGAGACCCUAACUUGUGAU...................................................  1         3.63
...............CCCUGAGACCCUAACUUG.......................................................  1         7.4
................CCUGAGACCCUAACUUGUGA....................................................  19        0.661
.................CUGAGACCCUAACUUGUGA....................................................  6         34.2
.................CUGAGACCCUAACUUGUG.....................................................  1         16.9
..................UGAGACCCUAACUUGUGA....................................................  2         0.0297
....................................UGUUUACCGUUUAAAUC...................................  1         0.239
...................................................UCCACGGGUUAGGCUCUUGGGAG..............  8         0.307
.....................................................CACGGGUUAGGCUCUUGGGAGC.............  2         0.0195
.....................................................CACGGGUUAGGCUCUUGGGAG..............  2         0.0297
......................................................ACGGGUUAGGCUCUUGGGAGCU............  119       1.5
......................................................ACGGGUUAGGCUCUUGGGAGC.............  56        0.578
......................................................ACGGGUUAGGCUCUUGGGAG..............  27        0.306
UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU
.((((..(((.(((..((..(((.(((((((((((..(((((.....))))).))))))))))).)))..))..))).)))..)))). (-43.40)
Stem-loop ID hsa-mir-125b-2
Mature ID hsa-miR-125b-5p
Reads 
               hsa-miR-125b-5p                    hsa-miR-125b-2-3p                         Count     RPM (mean number of reads per million)
................UCCCUGAGACCCUAACUUGUGA...................................................  9249      252
................UCCCUGAGACCCUAACUUGUG....................................................  504       435
................UCCCUGAGACCCUAACUUGU.....................................................  125       46
................UCCCUGAGACCCUAACUUG......................................................  18        48.6
................UCCCUGAGACCCUAACUU.......................................................  6         13.9
................UCCCUGAGACCCUAACU........................................................  4         0.032
.................CCCUGAGACCCUAACUUGUGA...................................................  62        374
.................CCCUGAGACCCUAACUUGUG....................................................  24        112
.................CCCUGAGACCCUAACUUGU.....................................................  10        43.4
.................CCCUGAGACCCUAACUUG......................................................  1         6.09
..................CCUGAGACCCUAACUUGUGA...................................................  19        0.544
...................CUGAGACCCUAACUUGUGA...................................................  6         28.1
...................CUGAGACCCUAACUUGUG....................................................  1         13.9
....................UGAGACCCUAACUUGUGA...................................................  2         0.0244
....................................................AUCACAAGUCAGGCUCUUGGGAC..............  2         0.0244
.....................................................UCACAAGUCAGGCUCUUGGG................  2         0.0355
.......................................................ACAAGUCAGGCUCUUGGGAC..............  10        0.178
.......................................................ACAAGUCAGGCUCUUGGGA...............  6         0.104
.......................................................ACAAGUCAGGCUCUUGGGACCU............  3         0.59
.......................................................ACAAGUCAGGCUCUUGGG................  1         5.03
........................................................CAAGUCAGGCUCUUGGGAC..............  2         0.03
ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGAGGGGA
.((...(((..(((((..((..(((.(((.((((((((..(((....)))...)))))))).))).)))..))..)))))..))).)). (-40.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 23embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 942embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 361melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 211melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 8170 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 85melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 57melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 657melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 123melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 357melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 123melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 137melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 534melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 23melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 7 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000139 GEO : GSM532875 normal cervix [ Witten D et al.]
ER0000000141 9 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000145 1 GEO : GSM532881 normal cervix [ Witten D et al.]
ER0000000147 14 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000154 2squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000157 23 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 136 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 99 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000169 28 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000171 49 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000173 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000175 5 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000177 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000181 35 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000183 29whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000185 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000193 9 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 2squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 5 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 22 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 11 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 28 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 5 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).