Deep sequencing reads for mature sequence MIMAT0000419

Stem-loop ID hsa-mir-27b
Mature ID hsa-miR-27b-3p
Reads 
                  hsa-miR-27b-5p                           hsa-miR-27b-3p                          Count     RPM (mean number of reads per million)
.................CAGAGCUUAGCUGAUUGGUGAACA........................................................  45        0.499
.................CAGAGCUUAGCUGAUUGGUGAAC.........................................................  5         0.0255
.................CAGAGCUUAGCUGAUUGGUGAA..........................................................  2         0.277
..................AGAGCUUAGCUGAUUGGUGAACA........................................................  632       6.36
..................AGAGCUUAGCUGAUUGGUGAAC.........................................................  220       16.2
..................AGAGCUUAGCUGAUUGGUGAACAG.......................................................  63        0.513
..................AGAGCUUAGCUGAUUGGUGAACAGU......................................................  49        0.646
..................AGAGCUUAGCUGAUUGGUGAA..........................................................  23        0.215
..................AGAGCUUAGCUGAUUGGUGA...........................................................  7         0.0377
..................AGAGCUUAGCUGAUUGGU.............................................................  1         9.77
........................................................UUUGUUCACAGUGGCUAAGUU....................  1         5.8
........................................................UUUGUUCACAGUGGCUAAGUUCUGC................  1         7.57
...........................................................GUUCACAGUGGCUAAGUUCUGC................  44        1.83
...........................................................GUUCACAGUGGCUAAGUUCUGCA...............  19        0.1
...........................................................GUUCACAGUGGCUAAGUUCU..................  6         0.0426
...........................................................GUUCACAGUGGCUAAGUUCUG.................  5         3.6
...........................................................GUUCACAGUGGCUAAGUUC...................  2         0.0113
............................................................UUCACAGUGGCUAAGUUCUGC................  2948      1.29e+03
............................................................UUCACAGUGGCUAAGUUCUGCA...............  816       8.76
............................................................UUCACAGUGGCUAAGUUCUG.................  709       525
............................................................UUCACAGUGGCUAAGUUC...................  660       129
............................................................UUCACAGUGGCUAAGUUCU..................  659       183
............................................................UUCACAGUGGCUAAGUU....................  595       133
.............................................................UCACAGUGGCUAAGUUCUGC................  5         1.64
..............................................................CACAGUGGCUAAGUUCUGC................  3         13.4
................................................................CAGUGGCUAAGUUCUGC................  1         9.77
ACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUG
((((((((....((((((((((((((((((....((((((((....(((...)))..))))))))..))))))))))))))))))..)))).)))). (-50.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 7embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 1138embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 2433melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 449melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 3905 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 327melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 1064melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 5327melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 349melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 2471melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2745melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 1789melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 1196melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 1319melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000136 60squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000138 3squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 4squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000141 5 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000142 64squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000143 6 GEO : GSM532879 normal cervix [ Witten D et al.]
ER0000000147 3 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000148 33squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000151 8 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000155 4 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000156 27squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 2 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000158 22squamous cell GEO : GSM532894 [ Witten D et al.]
ER0000000159 1 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000160 25squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000161 1 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000162 15squamous cell GEO : GSM532898 [ Witten D et al.]
ER0000000164 16squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000165 4 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000166 16squamous cell GEO : GSM532902 [ Witten D et al.]
ER0000000167 5 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000168 2adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000170 25adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000171 4 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000172 64squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000173 3 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000174 32squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000176 236adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 2 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000178 4squamous cell GEO : GSM532914 [ Witten D et al.]
ER0000000179 3 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000180 4squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000181 2 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000182 57squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000183 1whole body GEO : GSM532919 normal cervix [ Witten D et al.]
ER0000000184 26squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000185 6 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 3 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000188 7squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000189 3whole body GEO : GSM532925 normal cervix [ Witten D et al.]
ER0000000190 3squamous cell GEO : GSM532926 [ Witten D et al.]
ER0000000193 30 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 11squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 207 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 173 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 949 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 34 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 252 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 26 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).