Deep sequencing reads for mature sequence MIMAT0000227

Stem-loop ID

hsa-mir-197

Mature ID

hsa-miR-197-3p

Reads

        hsa-miR-197-5p                        hsa-miR-197-3p                 Count     RPM (mean number of reads per million)
........CGGGUAGAGAGGGCAGUGGGAGG............................................  93        2.11
........CGGGUAGAGAGGGCAGUGGGAG.............................................  54        1.03
........CGGGUAGAGAGGGCAGUGGGAGGU...........................................  10        0.168
........CGGGUAGAGAGGGCAGUGGGA..............................................  8         0.195
........CGGGUAGAGAGGGCAGUGG................................................  4         0.109
........CGGGUAGAGAGGGCAGUG.................................................  2         0.0257
............................................CCCUUCACCACCUUCUCCACCCAGC......  81        880
............................................CCCUUCACCACCUUCUCCACCCAG.......  60        395
............................................CCCUUCACCACCUUCUCCACCCAGCA.....  9         63
............................................CCCUUCACCACCUUCUCCACCCA........  8         95.5
............................................CCCUUCACCACCUUCUCCAC...........  2         15
............................................CCCUUCACCACCUUCUCCACCC.........  1         9.78
............................................CCCUUCACCACCUUCUC..............  1         9.78
...............................................UUCACCACCUUCUCCACCCAGC......  440       31.3
...............................................UUCACCACCUUCUCCACCCAG.......  114       12.5
...............................................UUCACCACCUUCUCCACCCAGCA.....  27        0.638
...............................................UUCACCACCUUCUCCACCCA........  1         0.316
................................................UCACCACCUUCUCCACCCAGCA.....  3         0.949
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC
((((((((.((((.(((((((..((((..((((((....))).)))..))))..))))))).)))).)))))))) (-42.40)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	2	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000002	19	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000103	156	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	23	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	83		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	7	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	109	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	130	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	37	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	89	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	53	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	42	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	74	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	60	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000135	1		GEO : GSM532871	normal cervix	[ Witten D et al.]
ER0000000141	3		GEO : GSM532877	normal cervix	[ Witten D et al.]
ER0000000147	6		GEO : GSM532883	normal cervix	[ Witten D et al.]
ER0000000156	1	squamous cell	GEO : GSM532892		[ Witten D et al.]
ER0000000157	13		GEO : GSM532893	normal cervix	[ Witten D et al.]
ER0000000161	74		GEO : GSM532897	normal cervix	[ Witten D et al.]
ER0000000165	116		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000169	42		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000171	30		GEO : GSM532907	normal cervix	[ Witten D et al.]
ER0000000175	10		GEO : GSM532911	normal cervix	[ Witten D et al.]
ER0000000181	48		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000183	40	whole body	GEO : GSM532919	normal cervix	[ Witten D et al.]
ER0000000262	9		GEO : GSM337570	antibody: anti-Ago1 4B8
ER0000000263	12		GEO : GSM337571	antibody: anti-Ago2 11A9

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).