Deep sequencing reads for mature sequence MIMAT0000109

Stem-loop ID dme-mir-4
Mature ID dme-miR-4-3p
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                dme-miR-4-5p                     dme-miR-4-3p                      Count     RPM (mean number of reads per million)
............UCUUUGGUCGUCCAGCCUUAGG...............................................  1576      172
............UCUUUGGUCGUCCAGCCUUAGGUGA............................................  1047      131
............UCUUUGGUCGUCCAGCCUUAGGU..............................................  177       16.8
............UCUUUGGUCGUCCAGCCUUAGGUG.............................................  164       22.1
............UCUUUGGUCGUCCAGCCUUAG................................................  116       19.6
............UCUUUGGUCGUCCAGCCUUA.................................................  11        0.65
............UCUUUGGUCGUCCAGCCUUAGGUGAU...........................................  5         0.633
............UCUUUGGUCGUCCAGCCUU..................................................  2         0.121
.............CUUUGGUCGUCCAGCCUUAGGUGA............................................  7011      824
.............CUUUGGUCGUCCAGCCUUAGGUG.............................................  1684      220
.............CUUUGGUCGUCCAGCCUUAGGU..............................................  810       90.2
.............CUUUGGUCGUCCAGCCUUAGG...............................................  238       28.7
.............CUUUGGUCGUCCAGCCUUAGGUGAU...........................................  22        1.36
.............CUUUGGUCGUCCAGCCUUAG................................................  17        3.22
.............CUUUGGUCGUCCAGCCUUAGGUGAUUU.........................................  4         0.222
..............UUUGGUCGUCCAGCCUUAGGUGA............................................  33        4.1
..............UUUGGUCGUCCAGCCUUAGGUG.............................................  6         2.15
..............UUUGGUCGUCCAGCCUUAGGU..............................................  3         0.135
..............UUUGGUCGUCCAGCCUUAGG...............................................  2         1.7
..............UUUGGUCGUCCAGCCUUAGGUGAU...........................................  1         0.0581
...............UUGGUCGUCCAGCCUUAGGUGA............................................  6         0.302
...............UUGGUCGUCCAGCCUUAGGUG.............................................  1         0.158
...................UCGUCCAGCCUUAGGUGA............................................  1         0.0989
..............................................UCAUAAAGCUAGACAACCAUUGA............  9         0.533
..............................................UCAUAAAGCUAGACAACC.................  1         0.0504
...............................................CAUAAAGCUAGACAACCAUUGA............  38        3.16
................................................AUAAAGCUAGACAACCAUUGAA...........  45835     4.24e+03
................................................AUAAAGCUAGACAACCAUUGA............  5263      513
................................................AUAAAGCUAGACAACCAUUGAAG..........  869       87.6
................................................AUAAAGCUAGACAACCAUUG.............  391       34.1
................................................AUAAAGCUAGACAACCAUU..............  12        0.854
................................................AUAAAGCUAGACAACCAUUGAAGU.........  7         0.695
................................................AUAAAGCUAGACAACCAU...............  5         0.387
.................................................UAAAGCUAGACAACCAUUGAAG..........  844       86.6
.................................................UAAAGCUAGACAACCAUUGAA...........  545       63.2
.................................................UAAAGCUAGACAACCAUUGA............  96        7.15
.................................................UAAAGCUAGACAACCAUUGAAGU.........  23        2.98
.................................................UAAAGCUAGACAACCAUUG.............  2         0.162
..................................................AAAGCUAGACAACCAUUGAA...........  46        5.32
..................................................AAAGCUAGACAACCAUUGAAG..........  3         0.167
..................................................AAAGCUAGACAACCAUUGA............  3         0.174
...................................................AAGCUAGACAACCAUUGAA...........  8         1.55
...................................................AAGCUAGACAACCAUUGAAG..........  1         0.713
...................................................AAGCUAGACAACCAUUGAAGUU........  1         0.823
....................................................AGCUAGACAACCAUUGAA...........  6         0.302
......................................................CUAGACAACCAUUGAAG..........  1         0.983
UUGCAAUUAGUUUCUUUGGUCGUCCAGCCUUAGGUGAUUUUUCCGGUCAUAAAGCUAGACAACCAUUGAAGUUCGUUGUGG
(..((((.(..(((..((((.(((.(((.....((((((.....))))))...))).))).))))..)))..).))))..) (-24.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000010 69head GEO : GSM240749 [ Chung WJ et al.]
ER0000000011 13S2 cell GEO : GSM272651 [ Chung WJ et al.]
ER0000000012 7S2 cell GEO : GSM272652 [ Chung WJ et al.]
ER0000000013 4Kc cell GEO : GSM272653 [ Chung WJ et al.]
ER0000000014 1imaginal disc GEO : GSM275691 [ Chung WJ et al.]
ER0000000015 3head GEO : GSM286601 [ Chung WJ et al.]
ER0000000017 1whole body GEO : GSM286603 [ Chung WJ et al.]
ER0000000018 3866embryo GEO : GSM286604 [ Chung WJ et al.]
ER0000000019 30512embryo GEO : GSM286605 [ Chung WJ et al.]
ER0000000020 8326embryo GEO : GSM286606 [ Chung WJ et al.]
ER0000000021 12188embryo GEO : GSM286607 [ Chung WJ et al.]
ER0000000022 13258embryo GEO : GSM286611 [ Chung WJ et al.]
ER0000000023 6614embryo GEO : GSM286613 [ Chung WJ et al.]
ER0000000079 12whole body GEO : GSM322208 3rd instar larvae
ER0000000080 6whole body GEO : GSM322219 2-4 day old pupae
ER0000000081 16whole body GEO : GSM322245 3rd instar larvae
ER0000000082 3whole body GEO : GSM322338 2-4 day old pupae
ER0000000083 42head GEO : GSM322533 adult female head
ER0000000084 279head GEO : GSM322543 adult male head
ER0000000085 70whole body GEO : GSM360256 1st instar larvae
ER0000000086 42whole body GEO : GSM360257 1st instar larvae
ER0000000087 28whole body GEO : GSM360260 0-1 day old pupae
ER0000000088 35whole body GEO : GSM360262 0-2 day old pupae
ER0000000089 338embryo GEO : GSM364902 12-24hr embryo
ER0000000092 2whole body GEO : GSM280084 from 2-4 day old flies
ER0000000095 4S2 cell GEO : GSM280087
ER0000000099 2imaginal disc GEO : GSM399105 imaginal disc/brain
ER0000000100 2whole body GEO : GSM399106 female body
ER0000000101 5whole body GEO : GSM399107 male body
ER0000000102 11S2 cell GEO : GSM371638
ER0000000115 11head GEO : GSM180328 adult heads (female heads, male heads) [ Ruby JG et al.]
ER0000000116 2whole body GEO : GSM180329 adult bodies (female bodies, male bodies) [ Ruby JG et al.]
ER0000000117 382embryo GEO : GSM180330 very early embryo (0-1) [ Ruby JG et al.]
ER0000000118 1506embryo GEO : GSM180331 early embryo (2-6) [ Ruby JG et al.]
ER0000000119 549embryo GEO : GSM180332 mid embryo (6-10) [ Ruby JG et al.]
ER0000000120 193embryo GEO : GSM180333 late embryo (12-24) [ Ruby JG et al.]
ER0000000127 7ovary GEO : GSM385744 Ovary Somatic Sheet (OSS) cells
ER0000000128 12ovary GEO : GSM385748 Ovary Somatic Sheet (OSS) cells
ER0000000129 13ovary GEO : GSM385821 Ovary Somatic Sheet (OSS) cells
ER0000000130 6ovary GEO : GSM385822 Ovary Somatic Sheet (OSS) cells
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18501606 "Endogenous RNA interference provides a somatic defense against Drosophila transposons" Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).