Deep sequencing reads for mature sequence MIMAT0000109

Stem-loop IDdme-mir-4
Mature IDdme-miR-4-3p
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                dme-miR-4-5p                     dme-miR-4-3p                      Count     RPM (mean number of reads per million)
............UCUUUGGUCGUCCAGCCUUAGG...............................................  1576      172
............UCUUUGGUCGUCCAGCCUUAGGUGA............................................  1047      131
............UCUUUGGUCGUCCAGCCUUAGGU..............................................  177       16.9
............UCUUUGGUCGUCCAGCCUUAGGUG.............................................  164       22.1
............UCUUUGGUCGUCCAGCCUUAG................................................  116       19.7
............UCUUUGGUCGUCCAGCCUUA.................................................  11        0.65
............UCUUUGGUCGUCCAGCCUUAGGUGAU...........................................  5         0.633
............UCUUUGGUCGUCCAGCCUU..................................................  2         0.121
.............CUUUGGUCGUCCAGCCUUAGGUGA............................................  7011      824
.............CUUUGGUCGUCCAGCCUUAGGUG.............................................  1684      220
.............CUUUGGUCGUCCAGCCUUAGGU..............................................  810       90.2
.............CUUUGGUCGUCCAGCCUUAGG...............................................  238       28.7
.............CUUUGGUCGUCCAGCCUUAGGUGAU...........................................  22        1.36
.............CUUUGGUCGUCCAGCCUUAG................................................  17        3.22
.............CUUUGGUCGUCCAGCCUUAGGUGAUUU.........................................  4         0.221
..............UUUGGUCGUCCAGCCUUAGGUGA............................................  33        4.1
..............UUUGGUCGUCCAGCCUUAGGUG.............................................  6         2.15
..............UUUGGUCGUCCAGCCUUAGGU..............................................  3         0.135
..............UUUGGUCGUCCAGCCUUAGG...............................................  2         1.7
..............UUUGGUCGUCCAGCCUUAGGUGAU...........................................  1         0.0581
...............UUGGUCGUCCAGCCUUAGGUGA............................................  6         0.302
...............UUGGUCGUCCAGCCUUAGGUG.............................................  1         0.158
...................UCGUCCAGCCUUAGGUGA............................................  1         0.0989
..............................................UCAUAAAGCUAGACAACCAUUGA............  9         0.533
..............................................UCAUAAAGCUAGACAACC.................  1         0.0504
...............................................CAUAAAGCUAGACAACCAUUGA............  38        3.16
................................................AUAAAGCUAGACAACCAUUGAA...........  45835     4.24e+03
................................................AUAAAGCUAGACAACCAUUGA............  5263      513
................................................AUAAAGCUAGACAACCAUUGAAG..........  869       87.6
................................................AUAAAGCUAGACAACCAUUG.............  391       34.2
................................................AUAAAGCUAGACAACCAUU..............  12        0.854
................................................AUAAAGCUAGACAACCAUUGAAGU.........  7         0.695
................................................AUAAAGCUAGACAACCAU...............  5         0.387
.................................................UAAAGCUAGACAACCAUUGAAG..........  844       86.6
.................................................UAAAGCUAGACAACCAUUGAA...........  545       63.2
.................................................UAAAGCUAGACAACCAUUGA............  96        7.15
.................................................UAAAGCUAGACAACCAUUGAAGU.........  23        2.98
.................................................UAAAGCUAGACAACCAUUG.............  2         0.162
..................................................AAAGCUAGACAACCAUUGAA...........  46        5.33
..................................................AAAGCUAGACAACCAUUGAAG..........  3         0.167
..................................................AAAGCUAGACAACCAUUGA............  3         0.174
...................................................AAGCUAGACAACCAUUGAA...........  8         1.55
...................................................AAGCUAGACAACCAUUGAAG..........  1         0.713
...................................................AAGCUAGACAACCAUUGAAGUU........  1         0.823
....................................................AGCUAGACAACCAUUGAA...........  6         0.302
......................................................CUAGACAACCAUUGAAG..........  1         0.984
UUGCAAUUAGUUUCUUUGGUCGUCCAGCCUUAGGUGAUUUUUCCGGUCAUAAAGCUAGACAACCAUUGAAGUUCGUUGUGG
(..((((.(..(((..((((.(((.(((.....((((((.....))))))...))).))).))))..)))..).))))..) (-24.30)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000010 69HeadGEO : GSM240749 [ Chung WJ et al.]
ER0000000011 13S2 cellGEO : GSM272651 [ Chung WJ et al.]
ER0000000012 7S2 cellGEO : GSM272652 [ Chung WJ et al.]
ER0000000013 4Kc cellGEO : GSM272653 [ Chung WJ et al.]
ER0000000014 1Imaginal discGEO : GSM275691 [ Chung WJ et al.]
ER0000000015 3HeadGEO : GSM286601 [ Chung WJ et al.]
ER0000000017 1Whole bodyGEO : GSM286603 [ Chung WJ et al.]
ER0000000018 3864EmbryoGEO : GSM286604 [ Chung WJ et al.]
ER0000000019 30506EmbryoGEO : GSM286605 [ Chung WJ et al.]
ER0000000020 8324EmbryoGEO : GSM286606 [ Chung WJ et al.]
ER0000000021 12186EmbryoGEO : GSM286607 [ Chung WJ et al.]
ER0000000022 13251EmbryoGEO : GSM286611 [ Chung WJ et al.]
ER0000000023 6610EmbryoGEO : GSM286613 [ Chung WJ et al.]
ER0000000079 12Whole bodyGEO : GSM3222083rd instar larvae
ER0000000080 6Whole bodyGEO : GSM3222192-4 day old pupae
ER0000000081 16Whole bodyGEO : GSM3222453rd instar larvae
ER0000000082 3Whole bodyGEO : GSM3223382-4 day old pupae
ER0000000083 42HeadGEO : GSM322533Age: Adult; Gender: Female
ER0000000084 279HeadGEO : GSM322543Age: Adult; Gender: Male
ER0000000085 70Whole bodyGEO : GSM3602561st instar larvae
ER0000000086 42Whole bodyGEO : GSM3602571st instar larvae
ER0000000087 28Whole bodyGEO : GSM3602600-1 day old pupae
ER0000000088 35Whole bodyGEO : GSM3602620-2 day old pupae
ER0000000089 338EmbryoGEO : GSM364902Age: 12-24 hours
ER0000000092 2Whole bodyGEO : GSM280084Age: 2-4 days
ER0000000095 4S2 cellGEO : GSM280087
ER0000000099 2Imaginal discGEO : GSM399105Imaginal disc/brain
ER0000000100 2Whole bodyGEO : GSM399106Gender: Female
ER0000000101 5Whole bodyGEO : GSM399107Gender: Male
ER0000000102 11S2 cellGEO : GSM371638
ER0000000115 11HeadGEO : GSM180328Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER0000000116 2Whole bodyGEO : GSM180329Age: Adult; Gender: Female & male[ Ruby JG et al.]
ER0000000117 382EmbryoGEO : GSM180330Very early embryo (0-1)[ Ruby JG et al.]
ER0000000118 1506EmbryoGEO : GSM180331Early embryo (2-6)[ Ruby JG et al.]
ER0000000119 549EmbryoGEO : GSM180332Mid embryo (6-10)[ Ruby JG et al.]
ER0000000120 193EmbryoGEO : GSM180333Late embryo (12-24)[ Ruby JG et al.]
ER0000000127 7OvaryGEO : GSM385744Ovary Somatic Sheet (OSS) cells
ER0000000128 12OvaryGEO : GSM385748Ovary Somatic Sheet (OSS) cells
ER0000000129 13OvaryGEO : GSM385821Ovary Somatic Sheet (OSS) cells
ER0000000130 6OvaryGEO : GSM385822Ovary Somatic Sheet (OSS) cells
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
2
PMID:18501606 "Endogenous RNA interference provides a somatic defense against Drosophila transposons" Chung WJ, Okamura K, Martin R, Lai EC Curr Biol. 18:795-802(2008).