Deep sequencing reads for mature sequence MIMAT0000100

Stem-loop ID hsa-mir-29b-1
Mature ID hsa-miR-29b-3p
Reads 
        hsa-miR-29b-1-5p                          hsa-miR-29b-3p                   Count     RPM (mean number of reads per million)
.........GCUGGUUUCAUAUGGUGGUUUAGA................................................  39        0.56
.........GCUGGUUUCAUAUGGUGGUUUAG.................................................  24        0.514
.........GCUGGUUUCAUAUGGUGGUUUA..................................................  21        0.483
.........GCUGGUUUCAUAUGGUGGUUU...................................................  5         0.235
.........GCUGGUUUCAUAUGGUGGUUUAGAU...............................................  2         0.035
..........CUGGUUUCAUAUGGUGGUUUA..................................................  2         0.0317
..........CUGGUUUCAUAUGGUGGUUUAG.................................................  2         0.035
.................................UUUAAAUAGUGAUUGUC...............................  136       1.8
.................................................CUAGCACCAUUUGAAAUCAGUGU.........  22        1.83
.................................................CUAGCACCAUUUGAAAUCAGUG..........  18        15.8
.................................................CUAGCACCAUUUGAAAUCAGUGUU........  5         0.0806
.................................................CUAGCACCAUUUGAAAUCAGU...........  5         18.6
.................................................CUAGCACCAUUUGAAAUCA.............  1         11.6
.................................................CUAGCACCAUUUGAAAUC..............  1         11.6
..................................................UAGCACCAUUUGAAAUCAGUGUU........  43160     641
..................................................UAGCACCAUUUGAAAUCAGUGU.........  4561      75.2
..................................................UAGCACCAUUUGAAAUCAGU...........  875       26.8
..................................................UAGCACCAUUUGAAAUCAGUG..........  707       39.1
..................................................UAGCACCAUUUGAAAUCAG............  167       2.61
..................................................UAGCACCAUUUGAAAUC..............  49        0.704
..................................................UAGCACCAUUUGAAAUCA.............  38        0.531
..................................................UAGCACCAUUUGAAAUCAGUGUUC.......  2         0.0133
...................................................AGCACCAUUUGAAAUCAGUGUU........  169       2.49
...................................................AGCACCAUUUGAAAUCAGUGU.........  12        0.198
...................................................AGCACCAUUUGAAAUCAGUG..........  2         0.035
...................................................AGCACCAUUUGAAAUCAGU...........  2         0.035
....................................................GCACCAUUUGAAAUCAGUGUU........  19        0.283
.....................................................CACCAUUUGAAAUCAGUG..........  1         36.8
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))). (-34.02)
Stem-loop ID hsa-mir-29b-2
Mature ID hsa-miR-29b-3p
Reads 
        hsa-miR-29b-2-5p                           hsa-miR-29b-3p                  Count     RPM (mean number of reads per million)
.........GCUGGUUUCACAUGGUGGCUUAGA................................................  4         0.0794
..........CUGGUUUCACAUGGUGGCUUAGA................................................  4         0.0462
..........CUGGUUUCACAUGGUGGCUUAGAU...............................................  4         4.3
..........CUGGUUUCACAUGGUGGCUUAG.................................................  1         15.7
..........CUGGUUUCACAUGGUGGCUU...................................................  1         4.27
..................................................CUAGCACCAUUUGAAAUCAGUGU........  22        1.86
..................................................CUAGCACCAUUUGAAAUCAGUG.........  18        16.1
..................................................CUAGCACCAUUUGAAAUCAGUGUU.......  5         0.0821
..................................................CUAGCACCAUUUGAAAUCAGU..........  5         18.9
..................................................CUAGCACCAUUUGAAAUC.............  1         11.8
..................................................CUAGCACCAUUUGAAAUCA............  1         11.8
...................................................UAGCACCAUUUGAAAUCAGUGUU.......  43160     653
...................................................UAGCACCAUUUGAAAUCAGUGU........  4561      76.6
...................................................UAGCACCAUUUGAAAUCAGUGUUU......  1228      18.3
...................................................UAGCACCAUUUGAAAUCAGU..........  875       27.4
...................................................UAGCACCAUUUGAAAUCAGUG.........  707       39.9
...................................................UAGCACCAUUUGAAAUCAG...........  167       2.66
...................................................UAGCACCAUUUGAAAUC.............  49        0.718
...................................................UAGCACCAUUUGAAAUCA............  38        0.541
...................................................UAGCACCAUUUGAAAUCAGUGUUUU.....  7         0.0583
....................................................AGCACCAUUUGAAAUCAGUGUU.......  169       2.53
....................................................AGCACCAUUUGAAAUCAGUGUUU......  13        0.173
....................................................AGCACCAUUUGAAAUCAGUGU........  12        0.202
....................................................AGCACCAUUUGAAAUCAGUG.........  2         0.0357
....................................................AGCACCAUUUGAAAUCAGU..........  2         0.0357
.....................................................GCACCAUUUGAAAUCAGUGUU.......  19        0.288
......................................................CACCAUUUGAAAUCAGUG.........  1         37.5
CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).))))))))) (-31.24)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 13embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 115embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 5486melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 1367melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 3983 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 4791melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 1472melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 8615melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 665melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 9831melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 6092melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 16877melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 2193melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 2168melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000135 2 GEO : GSM532871 normal cervix [ Witten D et al.]
ER0000000136 9squamous cell GEO : GSM532872 [ Witten D et al.]
ER0000000137 GEO : GSM532873 normal cervix [ Witten D et al.]
ER0000000141 12 GEO : GSM532877 normal cervix [ Witten D et al.]
ER0000000142 2squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000145 2 GEO : GSM532881 normal cervix [ Witten D et al.]
ER0000000147 1 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000148 2squamous cell GEO : GSM532884 [ Witten D et al.]
ER0000000149 1 GEO : GSM532885 normal cervix [ Witten D et al.]
ER0000000151 16 GEO : GSM532887 normal cervix [ Witten D et al.]
ER0000000155 1 GEO : GSM532891 normal cervix [ Witten D et al.]
ER0000000157 6 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000159 3 GEO : GSM532895 normal cervix [ Witten D et al.]
ER0000000161 8 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000163 9 GEO : GSM532899 normal cervix [ Witten D et al.]
ER0000000165 12 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000167 7 GEO : GSM532903 normal cervix [ Witten D et al.]
ER0000000169 2 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000170 1adenosquamous cell GEO : GSM532906 [ Witten D et al.]
ER0000000171 5 GEO : GSM532907 normal cervix [ Witten D et al.]
ER0000000172 9squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000173 40 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000175 2 GEO : GSM532911 normal cervix [ Witten D et al.]
ER0000000176 26adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000177 7 GEO : GSM532913 normal cervix [ Witten D et al.]
ER0000000179 1 GEO : GSM532915 normal cervix [ Witten D et al.]
ER0000000181 1 GEO : GSM532917 normal cervix [ Witten D et al.]
ER0000000182 4squamous cell GEO : GSM532918 [ Witten D et al.]
ER0000000184 1squamous cell GEO : GSM532920 [ Witten D et al.]
ER0000000185 19 GEO : GSM532921 normal cervix [ Witten D et al.]
ER0000000187 4 GEO : GSM532923 normal cervix [ Witten D et al.]
ER0000000189 1whole body GEO : GSM532925 normal cervix [ Witten D et al.]
ER0000000190 1squamous cell GEO : GSM532926 [ Witten D et al.]
ER0000000193 4 GEO : GSM532929 normal cervix [ Witten D et al.]
ER0000000194 1squamous cell GEO : GSM532930 [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 7 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 31 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 2 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
ER0000000266 10 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000267 1 GEO : GSM368184 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).