Deep sequencing reads for stem-loop sequence MI0019284

Stem-loop ID hsa-mir-5683
Reads 
            hsa-miR-5683                                                      Count     RPM (mean number of reads per million)
................................................AGUCAGGAUCUGCAUUUGAAU.......  2         0.609
GGAGCUUGUUACAGAUGCAGAUUCUCUGACUUCUUACUGCACCAGUGAAGUCAGGAUCUGCAUUUGAAUAAGACCC
((..((((((.(((((((((((.(.((((((((..((((...))))))))))))))))))))))))))))))..)) (-36.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000103 2melanoblast GEO : GSM458535 [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).