Deep sequencing reads for stem-loop sequence MI0019143

Stem-loop ID hsa-mir-5586
Reads 
hsa-miR-5586-5p                      hsa-miR-5586-3p           Count     RPM (mean number of reads per million)
.....................................CAGAGUGACAAGCUGGUU....  1         37
UAUCCAGCUUGUUACUAUAUGCUUUUUAAAUGGGGCACAGAGUGACAAGCUGGUUAAAG
...(((((((((((((...((((((......))))))...)))))))))))))...... (-27.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).