Deep sequencing reads for stem-loop sequence MI0017542

Stem-loop ID cel-mir-4812
Reads 
     cel-miR-4812-5p                      cel-miR-4812-3p                     Count     RPM (mean number of reads per million)
......AAGAGCGCUUGUAGUGAGUUGU................................................  2         4.56
AGAAGUAAGAGCGCUUGUAGUGAGUUGUCAAAAAUUGAGUAUGACAACCACUGCAAUUUCUCUAUUACAUUUUUGG
....(((((((...((((((((.(((((((...........)))))))))))))))...))))..)))........ (-23.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000024 1whole body GEO : GSM378784 [ de Wit E et al.]
ER0000000204 10adult GEO : GSM604033 strain: N2 wild-type, age: Day 10 [ de Lencastre A et al.]
ER0000000205 1adult GEO : GSM604034 strain: daf-2(e1379) mutant, age: Day 0 [ de Lencastre A et al.]
ER0000000206 1adult GEO : GSM604035 strain: daf-2(e1379) mutant, age: Day 10 [ de Lencastre A et al.]
ER0000000212 4whole body GEO : GSM139137 mixed-stage [ Ruby JG et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).
3
PMID:21129974 "MicroRNAs both promote and antagonize longevity in C. elegans" de Lencastre A, Pincus Z, Zhou K, Kato M, Lee SS, Slack FJ Curr Biol. 20:2159-2168(2010).