Deep sequencing reads for stem-loop sequence MI0017410

Stem-loop ID hsa-mir-4769
Reads 
       hsa-miR-4769-5p                        hsa-miR-4769-3p                   Count     RPM (mean number of reads per million)
GAGGAGAGGUGGGAUGGAGAGAAGGUAUGAGCUAAAAAUCCCCAAGCUCUGCCAUCCUCCCUCCCCUACUUCUCCCC
..((((((((((((.((((.((.((((.(((((...........))))))))).)))))).))))..)))))))).. (-38.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000164 4squamous cell GEO : GSM532900 [ Witten D et al.]
ER0000000174 2squamous cell GEO : GSM532910 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).