Deep sequencing reads for stem-loop sequence MI0017399

Stem-loop ID hsa-mir-4758
Reads 
hsa-miR-4758-5p                             hsa-miR-4758-3p              Count     RPM (mean number of reads per million)
................................................ugCcCCacCUGcugACCacCCuC  5         8.76
GGUGAGUGGGAGCCGGUGGGGCUGGAGUAAGGGCACGCCCGGGGCUGCCCCACCUGCUGACCACCCUCCCC
((.(.((((.(((.((((((((...(((..(((....)))...))))))))))).)))..)))).).)).. (-39.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 5embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).