Deep sequencing reads for stem-loop sequence MI0017386

Stem-loop ID hsa-mir-4747
Reads 
hsa-miR-4747-5p                 hsa-miR-4747-3p           Count     RPM (mean number of reads per million)
AGGGAAGGAGGCUUGGUCUUAGCACGGGGUCUAAGGCCCGGGCUUUCCUCCCAG
.((((.(((((((((((((((((.....).)))))).)))))))))).)))).. (-28.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000168 1adenosquamous cell GEO : GSM532904 [ Witten D et al.]
ER0000000180 2squamous cell GEO : GSM532916 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).