Deep sequencing reads for stem-loop sequence MI0017361

Stem-loop ID hsa-mir-4724
Reads 
         hsa-miR-4724-5p                                hsa-miR-4724-3p                    Count     RPM (mean number of reads per million)
..........AACUGAACCAGGAGUGAGCUUCG........................................................  10        3.68
..........AACUGAACCAGGAGUGAGCUUC.........................................................  3         1.14
..........AACUGAACCAGGAGUGAGCUU..........................................................  2         0.761
ACGCAAAAUGAACUGAACCAGGAGUGAGCUUCGUGUACAUUAUCUAUUAGAAAAUGAAGUACCUUCUGGUUCAGCUAGUCCCUGUGCGU
(((((....((.((((((((((((.(.(((((((...................))))))).)))))))))))))....))....))))) (-32.61)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000110 12melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).