Deep sequencing reads for stem-loop sequence MI0016802

Stem-loop ID hsa-mir-4456
Reads
    hsa-miR-4456                            Count     RPM (mean number of reads per million)
AUGAACCUGGUGGCUUCCUUUUCUGGGAGGAAGUUAGGGUUCA
.(((((((..(((((((((((....)))))))))))))))))) (-20.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000105 3 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000109 2melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2