Deep sequencing reads for stem-loop sequence MI0016765

Stem-loop ID hsa-mir-4426
Reads 
    hsa-miR-4426                                                Count     RPM (mean number of reads per million)
AGUUGGAAGAUGGACGUACUUUGUCUGACUACAAUAUUCAAAAGGAGUCUACUCUUCAUCUUG
.....((((((((((...((((..................))))..))))).)))))...... (-12.57)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000103 3melanoblast GEO : GSM458535 [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).