Deep sequencing reads for stem-loop sequence MI0016684

Stem-loop ID

hsa-mir-374c

Reads

           hsa-miR-374c-5p           hsa-miR-374c-3p                     Count     RPM (mean number of reads per million)
............AUAAUACAACCUGCUAAGUG......................................  38        1.82
ACACGGACAAUGAUAAUACAACCUGCUAAGUGCUAGGACACUUAGCAGGUUGUAUUAUAUCCAUCCGAGU
...((((.....((((((((((((((((((((......)))))))))))))))))))).....))))... (-37.30)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000103	2	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000106	4	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000108	12	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000110	11	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	7	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	11	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000114	3	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000149	2		GEO : GSM532885	normal cervix	[ Witten D et al.]
ER0000000155	2		GEO : GSM532891	normal cervix	[ Witten D et al.]
ER0000000159	1		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000163	4		GEO : GSM532899	normal cervix	[ Witten D et al.]
ER0000000167	7		GEO : GSM532903	normal cervix	[ Witten D et al.]
ER0000000173	9		GEO : GSM532909	normal cervix	[ Witten D et al.]
ER0000000177	2		GEO : GSM532913	normal cervix	[ Witten D et al.]
ER0000000185	11		GEO : GSM532921	normal cervix	[ Witten D et al.]
ER0000000187	7		GEO : GSM532923	normal cervix	[ Witten D et al.]

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).