Deep sequencing reads for stem-loop sequence MI0016597

Stem-loop ID hsa-mir-3940
Reads 
                    hsa-miR-3940-5p                    hsa-miR-3940-3p                                   Count     RPM (mean number of reads per million)
......................GUGGGUUGGGGCGGGCUCU.............................................................  2         0.146
........................................................CAGCCCGGAUCCCAGCCCACUU........................  15        6.87
........................................................CAGCCCGGAUCCCAGCCCACU.........................  15        0.861
........................................................CAGCCCGGAUCCCAGCCCACUUAC......................  1         71.6
GCUUAUCGAGGAAAAGAUCGAGGUGGGUUGGGGCGGGCUCUGGGGAUUUGGUCUCACAGCCCGGAUCCCAGCCCACUUACCUUGGUUACUCUCCUUCCUUCU
.......(((((...((((((((((((((((((((((((.(((((......))))).))))))..)))))))))....)))))))))....)))))...... (-46.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000103 4melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 5melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 3melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000111 5melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 7melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 3melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000154 1squamous cell GEO : GSM532890 [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000188 1squamous cell GEO : GSM532924 [ Witten D et al.]
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000265 1 GEO : GSM368182 tissue: clinically negative of NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).