Deep sequencing reads for stem-loop sequence MI0016301

Stem-loop ID tca-mir-3837
Confidence
Feedback: Do you believe this miRNA is real?
Reads
  tca-miR-3837-5p                                                               tca-miR-3837-3p                Count     RPM (mean number of reads per million)
AAAAACAUUUGUCUAAUAAAUAAAUCUUGAGACGUUUUUUUAAACUUGUUAAGACAUUAUGAGCGAGAGUGAGAUAUUGUCGGAAGAUUGUUUUUAUGAAAGUGAACAG
.....(((((.....(((((..((((((..((((...(((((..((((((...........))))))..)))))...))))..))))))...)))))..)))))..... (-22.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000199 26adult GEO : GSM639446 genotype: wild type, gender: male and female [ Marco A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).