Deep sequencing reads for stem-loop sequence MI0016265

Stem-loop IDtca-mir-3808
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                             tca-miR-3808-5p                      tca-miR-3808-3p                                 Count     RPM (mean number of reads per million)
............................UCUCAUAUUCGCACUUGACAU...............................................................  2         0.516
..............................UCAUAUUCGCACUUGACAUAUU............................................................  82        21.2
..............................UCAUAUUCGCACUUGACAUAU.............................................................  68        17.5
..............................UCAUAUUCGCACUUGACA................................................................  40        10.3
..............................UCAUAUUCGCACUUGACAUA..............................................................  24        6.19
..............................UCAUAUUCGCACUUGACAU...............................................................  18        4.64
..............................UCAUAUUCGCACUUGACAUAUUU...........................................................  2         0.516
..............................UCAUAUUCGCACUUGACAUAUUUUGG........................................................  2         0.516
...............................CAUAUUCGCACUUGACAUAUU............................................................  8         2.06
...............................CAUAUUCGCACUUGACAUA..............................................................  4         1.03
...............................CAUAUUCGCACUUGACAUAU.............................................................  4         1.03
...............................CAUAUUCGCACUUGACAU...............................................................  2         0.516
...............................CAUAUUCGCACUUGACAUAUUU...........................................................  2         0.516
................................AUAUUCGCACUUGACAUAUU............................................................  2         0.516
...................................................................UAUGUACACGUGUGGAUAUGGGG......................  10        2.58
...................................................................UAUGUACACGUGUGGAUAUGGG.......................  4         1.03
...................................................................UAUGUACACGUGUGGAUAU..........................  4         1.03
...................................................................UAUGUACACGUGUGGAUAUGGGGCCG...................  2         0.516
...................................................................UAUGUACACGUGUGGAUA...........................  2         0.516
....................................................................AUGUACACGUGUGGAUAUGGG.......................  2         0.516
....................................................................AUGUACACGUGUGGAUAUGGGG......................  2         0.516
UUUAAGAGGGUUUUAACCAAUUUUUCAGUCUCAUAUUCGCACUUGACAUAUUUUGGAUUAAAUAAAAUAUGUACACGUGUGGAUAUGGGGCCGAAGUUGGUACAGUCAACGG
.....((..((....(((((((((...(((((((((((((((.((((((((((((.......)))))))))).)).))))))))))))))).)))))))))))..))..... (-41.20)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000199 570AdultGEO : GSM639446Genotype: Wild type; Gender: Male and female[ Marco A et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).