Deep sequencing reads for stem-loop sequence MI0014583

Stem-loop ID aly-MIR397a
Reads 
                  aly-miR397a-5p                                                      aly-miR397a-3p                            Count     RPM (mean number of reads per million)
...................UCAUUGAGUGCAGCGUUGAUG......................................................................................  1         41.6
UCCUGGAUUUGAAUGAACAUCAUUGAGUGCAGCGUUGAUGUAAUUUCCUUUUUUUUUCAUUGUUGAAUGGAAUUAAAAGAAUUUACACCGGCGUUGCGCUCAAUUAUGUUUUUCUUAUUUUCAGGA
(((((((..(((..((((((.((((((((((((((((.(((((.(((.((((..(((((((....)))))))..))))))).))))).)))))))))))))))).))))))...)))..))))))) (-55.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000207 1rosette leaf GEO : GSM451894 8 weeks [ Ma Z et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20407023 "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus" Ma Z, Coruh C, Axtell MJ Plant Cell. 22:1090-1103(2010).