Deep sequencing reads for stem-loop sequence MI0014128

Stem-loop ID hsa-mir-3116-1
Reads 
                                              hsa-miR-3116                  Count     RPM (mean number of reads per million)
............................................UGCCUGGAACAUAGUAGGGACU........  7         4.84
CUUUAUUGAGUCCCUACUAUGUUCCAGGCACUGGGUAUCGUAGGUGCCUGGAACAUAGUAGGGACUCAAUAAAG
((((((((((((((((((((((((((((((((..........)))))))))))))))))))))))))))))))) (-57.60)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000110 3melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).