Deep sequencing reads for stem-loop sequence MI0013859

Stem-loop ID bmo-mir-2733h
Reads
                                                 bmo-miR-2733h                    Count     RPM (mean number of reads per million)
.................................................UCACUGGGUGUAUGAUGAUUGU..........  2         0.691
UCUCUCUAAUGCAGUCAUCAUACUCUGAGUUGAUAUGUGGAAAAUUCUAUCACUGGGUGUAUGAUGAUUGUGGUAGAGAGA
((((((((..(((((((((((((.((.(((.((((.((.....))..))))))).)).)))))))))))))..)))))))) (-38.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000268 2whole body GEO : GSM449725 5th-instar day-3 larvae [ Liu S et al.]
ER0000000269 1anterior silk glands GEO : GSM449726 5th-instar day-3 larvae [ Liu S et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).