Deep sequencing reads for stem-loop sequence MI0012122

Stem-loop ID cte-mir-2686c
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                                      cte-miR-2686c                   Count     RPM (mean number of reads per million)
.....................................................AAAGAUGUUCUUAAUGUAGGUUUC........  3         86.9
.....................................................AAAGAUGUUCUUAAUGUAGGUUU.........  3         86.9
.....................................................AAAGAUGUUCUUAAUGUAGGU...........  1         29
......................................................AAGAUGUUCUUAAUGUAGGUUU.........  143       4.14e+03
......................................................AAGAUGUUCUUAAUGUAGGUUUC........  122       3.54e+03
......................................................AAGAUGUUCUUAAUGUAGGUU..........  21        609
......................................................AAGAUGUUCUUAAUGUAGGUUUCU.......  10        290
......................................................AAGAUGUUCUUAAUGUAGGU...........  6         174
.......................................................AGAUGUUCUUAAUGUAGGUUUC........  6         174
.......................................................AGAUGUUCUUAAUGUAGGUUU.........  2         58
.......................................................AGAUGUUCUUAAUGUAGGU...........  1         29
........................................................GAUGUUCUUAAUGUAGGUUU.........  1         29
UAUCACAAGAACCUAUAUUUGGGACAGCUCUCAUGGAACUCUUGAUAUCAUAGAAAGAUGUUCUUAAUGUAGGUUUCUUGUGCUG
...((((((((((((((((.((((((.((.((((((..(....)...)))).)).)).)))))).)))))))).))))))))... (-28.30)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000125 408Whole body [ Wheeler BM et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).