Deep sequencing reads for stem-loop sequence MI0011284

Stem-loop ID hsa-mir-2277
Reads 
                 hsa-miR-2277-5p                        hsa-miR-2277-3p                        Count     RPM (mean number of reads per million)
.................AGCGCGGGCUGAGCGCUGCCAGUC....................................................  22        1.19
.................AGCGCGGGCUGAGCGCUGCCAGUCA...................................................  14        0.803
.................AGCGCGGGCUGAGCGCUGCCAGU.....................................................  5         0.308
.........................................................CUGACAGCGCCCUGCCUGGCUCG.............  1         6.73
..........................................................UGACAGCGCCCUGCCUGGCUC..............  1         0.805
..........................................................UGACAGCGCCCUGCCUGGCUCG.............  1         20.6
GUGCUUCCUGCGGGCUGAGCGCGGGCUGAGCGCUGCCAGUCAGCGCUCACAUUAAGGCUGACAGCGCCCUGCCUGGCUCGGCCGGCGAAGCUC
..(((((..((.((((((((.(((((.(.((((((.(((((..............))))).)))))).).))))))))))))).))))))).. (-54.94)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 1embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 16melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 2melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000107 2melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 2melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000110 19melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000114 3melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000266 1 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).