Deep sequencing reads for stem-loop sequence MI0011142

Stem-loop ID ppc-mir-63c-4
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                                                     ppc-miR-63c                                     Count     RPM (mean number of reads per million)
..................................................................UAUGACACUCAAUGCGAGAUGGG...........................  2         208
..................................................................UAUGACACUCAAUGCGAGAUG.............................  1         104
..................................................................UAUGACACUCAAUGCGAGAUGG............................  1         104
GGUACCCGAACCAUAAUCCAUGUGGGGUUCCAUUCGCAUGAGUUUCAUGGACUCGAUUCAUAGAUCUAUGACACUCAAUGCGAGAUGGGACCUCGGUGGACCAAUGGUUCGGUACC
((((((.(((((((..(((((.(((((((((((((((((((((.(((((((.((........))))))))).)))).)))))).))))))))))))))))...))))))))))))) (-64.10)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000027 118Whole body GEO : GSM378787 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).