Deep sequencing reads for stem-loop sequence MI0011139

Stem-loop ID ppc-mir-63c-1
Reads
                                                              ppc-miR-63c                               Count     RPM (mean number of reads per million)
...........................................................UAUGACACUCAAUGCGAGAUGGG.....................  2         218
...........................................................UAUGACACUCAAUGCGAGAUG.......................  1         109
...........................................................UAUGACACUCAAUGCGAGAUGG......................  1         109
GAAUCAUAGUCCAUGUGGGGUUCCAUUCGCAUGAGUUUCAUGGACUCGAUUCAUAGAUCUAUGACACUCAAUGCGAGAUGGGACCUCGGUGGGCCAAUGGUUC
(((((((.((((((.(((((((((((((((((((((.(((((((.((........))))))))).)))).)))))).)))))))))))))))))..))))))) (-53.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000027 118whole body GEO : GSM378787 [ de Wit E et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).