Deep sequencing reads for stem-loop sequence MI0010321

Stem-loop ID osa-MIR1846c
Reads
                 osa-miR1846c-5p              osa-miR1846c-3p                           Count     RPM (mean number of reads per million)
...................AGUGAGGAGGCCGGGGCCGCU..............................................  1         15.8
AUGAGCCGCCGGAUCUCCCAGUGAGGAGGCCGGGGCCGCUGAAUCCGGUGACCCCGGUCUGCUCGCUGGCGGAUCCGGCGCAAAGA
....((.(((((((((.((((((((.(((((((((.(((((....))))).))))))))).)))))))).)))))))))))..... (-64.70)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000009 2whole body GEO : GSM407072 [ Johnson C et al.]
ER0000000201 20whole body GEO : GSM571077 strain: indica 93-11, age: 12-day-old, stress: control [ Li T et al.]
ER0000000202 21whole body GEO : GSM571078 strain: indica 93-11, stress: H2O2 [ Li T et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).
2