Deep sequencing reads for stem-loop sequence MI0009982

Stem-loop ID hsa-mir-1972-1
Reads 
                                                 hsa-miR-1972                  Count     RPM (mean number of reads per million)
UAUAGGCAUGUGCCACCACACC.......................................................  1         0.657
UAUAGGCAUGUGCCACCACACCUGGCUUAAAUGUGUCAUUUAAAAAUUCAGGCCAGGCACAGUGGCUCAUGCCUGUA
((((((((((.(((((....((((((((.(((.............))).))))))))....))))).)))))))))) (-38.12)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 7embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000103 2melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000111 2melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000138 1squamous cell GEO : GSM532874 [ Witten D et al.]
ER0000000140 1squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000173 1 GEO : GSM532909 normal cervix [ Witten D et al.]
ER0000000266 1 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).