Deep sequencing reads for stem-loop sequence MI0008331

Stem-loop ID hsa-mir-1910
Reads 
            hsa-miR-1910                                                         Count     RPM (mean number of reads per million)
..........GCCAGUCCUGUGCCUGCCGCCU................................................  1         0.375
...........CCAGUCCUGUGCCUGCCGCCU................................................  15        5.89
...........CCAGUCCUGUGCCUGCCGC..................................................  2         0.751
...........CCAGUCCUGUGCCUGCCGCC.................................................  1         0.375
...........CCAGUCCUGUGCCUGCCGCCUUU..............................................  1         0.375
...........CCAGUCCUGUGCCUGCCG...................................................  1         0.375
...........CCAGUCCUGUGCCUGCCGCCUU...............................................  1         0.375
..................................................GAGGCAGAAGCAGGAUGACAA.........  6         0.289
..................................................GAGGCAGAAGCAGGAUGACA..........  6         0.296
..................................................GAGGCAGAAGCAGGAUGACAAU........  3         0.0653
..................................................GAGGCAGAAGCAGGAUGAC...........  1         5.29
UGUCCCUUCAGCCAGUCCUGUGCCUGCCGCCUUUGUGCUGUCCUUGGAGGGAGGCAGAAGCAGGAUGACAAUGAGGGCAA
((.((((.((....(((((((..(((((.(((((............))))).)))))..))))))).....)))))))). (-34.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 26embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 2embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 3melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000108 5melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 3melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 4melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000140 1squamous cell GEO : GSM532876 [ Witten D et al.]
ER0000000157 2 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000180 1squamous cell GEO : GSM532916 [ Witten D et al.]
ER0000000186 2squamous cell GEO : GSM532922 [ Witten D et al.]
ER0000000262 2 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 1 GEO : GSM337571 antibody: anti-Ago2 11A9
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).