Deep sequencing reads for stem-loop sequence MI0006422

Stem-loop ID

hsa-mir-548i-2

Reads

                                        hsa-miR-548i                                                                                                   Count     RPM (mean number of reads per million)
......................................AAAAGUAAUUGCGGAUUUUGCC.........................................................................................  2         0.0381
UAGAUGGCUCCGAAGUUUGCAUCCUAUUAGUUUGGUGCAAAAGUAAUUGCGGAUUUUGCCAUUAAAAGUAAUGGCAAAAAUAGCAAUUAUUUUUGUACCAGCCUAGUAUCUUUUCUCCUUCUAACAAAGUUCGUCCCUGAUCCAUCUCA
.((((((.((((((.((((.....((((((.(((((((((((((((((((...(((((((((((....)))))))))))...))))))))))))))))))).))))))................)))).)))).....)).)))))).. (-54.90)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000002	1	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000103	138	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	10	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	13		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	16	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	59	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	21	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	13	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	57	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	30	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	38	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	21	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	33	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000159	1		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000173	1		GEO : GSM532909	normal cervix	[ Witten D et al.]
ER0000000187	1		GEO : GSM532923	normal cervix	[ Witten D et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).