Deep sequencing reads for stem-loop sequence MI0006391

Stem-loop ID hsa-mir-1257
Reads 
                      hsa-miR-1257                                                                                    Count     RPM (mean number of reads per million)
.....................AGUGAAUGAUGGGUUCUGACC...........................................................................  2         0.473
GCCCUGGGCUUGUGCUUGGGGAGUGAAUGAUGGGUUCUGACCCCCAUGCACCCCUGUGGGCCCCUGGCAUCACUGGCCCCAUCCUUCACCCCUGCCAACCACGCUUGCCCUGUGCCU
((.(.((((.((((.((((((.(((((.((((((..((((...(((.(..(((....)))..).)))..)))..)..)))))).))))).))..)))).))))...)))).).)).. (-45.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000112 2melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000157 1 GEO : GSM532893 normal cervix [ Witten D et al.]
ER0000000160 1squamous cell GEO : GSM532896 [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).