Deep sequencing reads for stem-loop sequence MI0006375

Stem-loop ID

hsa-mir-548f-2

Reads

                                                          hsa-miR-548f                             Count     RPM (mean number of reads per million)
.........................................................CAAAAACUGUAAUUACUUUUGC...................  13        1.56
UAAUAACUAUUAGGUUGGUGCGAACAUAAUUGCAGUUUUUAUCAUUACUUUUAAUGGCAAAAACUGUAAUUACUUUUGCACCAACCUAAUAUUUUAGU
.......(((((((((((((((((..((((((((((((((..(((((....)))))..))))))))))))))..)))))))))))))))))....... (-46.10)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000103	8	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000107	2	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	2	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	3	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	4	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000159	1		GEO : GSM532895	normal cervix	[ Witten D et al.]
ER0000000173	1		GEO : GSM532909	normal cervix	[ Witten D et al.]

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).