Deep sequencing reads for stem-loop sequence MI0006369

Stem-loop IDhsa-mir-1302-8
Confidence
Feedback: Do you believe this miRNA is real?
Reads
                                                                  hsa-miR-1302                                                   Count     RPM (mean number of reads per million)
.................................................................UUGGGACAUACUUAUGCUAAA..........................................  3         4.3
.................................................................UUGGGACAUACUUAUGCU.............................................  2         8.79
.................................................................UUGGGACAUACUUAUGCUAA...........................................  1         5.57
.................................................................UUGGGACAUACUUAUGCUA............................................  1         5.57
..................................................................UGGGACAUACUUAUGCUAAA..........................................  1         1.55
CCCAUUUAAACUUGAAUUUCAUAUAAACACCGUAAUUUUCAGCAUUAGUGUAUCACAUGCAGUAUUUGGGACAUACUUAUGCUAAAAAAUUAGGUGGUGUUGAUCUGAAAUUCCAGUGUAGAUGGGCA
((((((((.(((.((((((((.((.((((((((((((((.(((((.(((((.((.((.........)).)).))))).)))))..)))))))..))))))).)).)))))))).))).)))))))).. (-44.50)

Filter reads

by experiment
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).