Deep sequencing reads for stem-loop sequence MI0006313

Stem-loop ID hsa-mir-1226
Reads 
 hsa-miR-1226-5p                                    hsa-miR-1226-3p           Count     RPM (mean number of reads per million)
.UGAGGGCAUGCAGGCCUGGAUGGGG.................................................  3         0.254
.UGAGGGCAUGCAGGCCUGGAUG....................................................  1         0.984
..........................CAGCUGGGAUGGUCCAAAAGGGUGGCC......................  9         0.702
.....................................................UCACCAGCCCUGUGUUCCCUAG  11        59.8
.....................................................UCACCAGCCCUGUGUUCCCU..  4         36.8
.....................................................UCACCAGCCCUGUGUUCC....  1         0.984
GUGAGGGCAUGCAGGCCUGGAUGGGGCAGCUGGGAUGGUCCAAAAGGGUGGCCUCACCAGCCCUGUGUUCCCUAG
...((((.(((((((.((((.((((((.(((.((.....)).....))).)))))))))).))))))).)))).. (-36.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 3embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 4embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000105 2 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000109 2melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 6melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 2melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000262 8 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 5 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 1 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).