Deep sequencing reads for stem-loop sequence MI0006302

Stem-loop ID mmu-mir-467h
Reads 
                                                                                 mmu-miR-467h                              Count     RPM (mean number of reads per million)
...............................................................................AUAAGUGUGUGCAUGUAUAUGU....................  4         1.2
................................................................................UAAGUGUGUGCAUGUAUAUGUG...................  1         0.0109
...................................................................................GUGUGUGCAUGUAUAUG.....................  1         0.00239
.....................................................................................GUGUGCAUGUAUAUGUG...................  1         0.0109
UUUUCACUUUUGUUUUUCUCAUGUAUAUGUGUAUGUGUGCGGUGUACAUAAUUAUAUCUAUGUGUGCAUGUAUGUGGACAUAAGUGUGUGCAUGUAUAUGUGUGUGUGUGGUGUACAUAAU
...............................((((((..(.(..((((((..(((((.((((((..(((.((((....)))).)))..)))))).)))))))))))..).)..)))))).. (-34.00)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000029 9ovary GEO : GSM510433 [ Chiang HR et al.]
ER0000000030 18ovary GEO : GSM510434 [ Chiang HR et al.]
ER0000000031 1ovary GEO : GSM510435 [ Chiang HR et al.]
ER0000000032 46testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000033 146testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 220testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000035 31testes GEO : GSM510439 [ Chiang HR et al.]
ER0000000036 13brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 113brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 150brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 17brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000040 616brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 15whole body GEO : GSM510446 newborn [ Chiang HR et al.]
ER0000000043 21whole body GEO : GSM510447 Newborn. [ Chiang HR et al.]
ER0000000044 5whole body GEO : GSM510448 Newborn. [ Chiang HR et al.]
ER0000000045 56whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000046 78whole body GEO : GSM510450 Newborn. [ Chiang HR et al.]
ER0000000047 103whole body GEO : GSM510451 Newborn. [ Chiang HR et al.]
ER0000000048 111whole body GEO : GSM510452 Newborn. [ Chiang HR et al.]
ER0000000049 102whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 104whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000051 90whole body GEO : GSM510455 Newborn. [ Chiang HR et al.]
ER0000000052 387whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000053 104embryo GEO : GSM510457 Day 12.5 embryo [ Chiang HR et al.]
ER0000000054 371embryo GEO : GSM510458 day 12.5 embryo [ Chiang HR et al.]
ER0000000055 575embryo GEO : GSM510459 day 12.5 embryo [ Chiang HR et al.]
ER0000000056 84embryo GEO : GSM510460 day 12.5 embryo [ Chiang HR et al.]
ER0000000057 382embryo GEO : GSM510461 day 9.5 embryo [ Chiang HR et al.]
ER0000000058 742embryo GEO : GSM510462 day 9.5 embryo [ Chiang HR et al.]
ER0000000059 1307embryo GEO : GSM510463 day 9.5 embryo [ Chiang HR et al.]
ER0000000060 105embryo GEO : GSM510464 day 9.5 embryo [ Chiang HR et al.]
ER0000000061 262embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000062 436embryo GEO : GSM510466 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 799embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000216 76bone marrow GEO : GSM539835 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000217 57bone marrow GEO : GSM539836 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000218 60spleen GEO : GSM539837 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000219 12spleen GEO : GSM539838 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000220 24spleen GEO : GSM539839 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000221 131spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 594spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000223 311spleen GEO : GSM539842 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000224 127spleen GEO : GSM539843 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000225 6peritoneal lavage GEO : GSM539844 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000226 29spleen GEO : GSM539845 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000227 45lymph nodes GEO : GSM539846 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000228 33lymph nodes GEO : GSM539847 strain: IL-6 transgenic, gender: male, isolation: fluorescence activated cell sorting
ER0000000229 76bone marrow GEO : GSM539848 strain: C57BL/6J, gender: male
ER0000000231 45bone marrow GEO : GSM539850 strain: C57BL/6J, gender: male
ER0000000232 390peritoneal lavage GEO : GSM539851 strain: C57BL/6J, gender: male
ER0000000233 87peritoneal lavage GEO : GSM539852 strain: C57BL/6J, gender: male
ER0000000234 24bone marrow GEO : GSM539853 strain: C57BL/6J, gender: male
ER0000000235 104bone marrow GEO : GSM539854 strain: C57BL/6J, gender: male
ER0000000236 24spleen GEO : GSM539855 strain: RAG-/-, gender: male
ER0000000237 170thymus GEO : GSM539856
ER0000000238 600spleen GEO : GSM539857 strain: C57BL/6J, gender: male
ER0000000239 708spleen GEO : GSM539858 strain: C57BL/6J, gender: male
ER0000000240 169spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000241 111lymph nodes/spleen GEO : GSM539860 strain: C57BL/6J, gender: male
ER0000000242 140lymph nodes/spleen GEO : GSM539861 strain: C57BL/6J, gender: male
ER0000000243 403lymph nodes/spleen GEO : GSM539862 strain: C57BL/6J, gender: male
ER0000000244 908spleen GEO : GSM539863 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000245 329lymph nodes/spleen GEO : GSM539864 strain: C57BL/6J, gender: male
ER0000000246 612lymph nodes/spleen GEO : GSM539865 strain: C57BL/6J, gender: male, isolation: fluorescence activated cell sorting
ER0000000247 2666 GEO : GSM539866 strain: C57BL/6-129
ER0000000248 90 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000249 2heart GEO : GSM539868 strain: C57BL/6J, gender: male
ER0000000250 19brain GEO : GSM539869 strain: C57BL/6J, gender: male
ER0000000251 11lung GEO : GSM539870 strain: C57BL/6J, gender: male
ER0000000253 1kidney GEO : GSM539872 strain: C57BL/6J, gender: male
ER0000000254 9pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000255 54skin GEO : GSM539874 strain: C57BL/6J, gender: male
ER0000000256 108skeletal muscle GEO : GSM539875 strain: C57BL/6J, gender: male
ER0000000257 111salivary glands GEO : GSM539876 strain: C57BL/6J, gender: male
ER0000000258 67testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000259 17ovary GEO : GSM539878 strain: C57BL/6J, gender: female
ER0000000260 149spleen GEO : GSM539879 strain: BclXL transgenic BalbC, gender: male
ER0000000261 99lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).