Deep sequencing reads for stem-loop sequence MI0006297

Stem-loop ID mmu-mir-1192
Reads 
                     mmu-miR-1192                                                                                          Count     RPM (mean number of reads per million)
...................AAACAAACAAACAGACCAAAUU................................................................................  1         0.0131
...................AAACAAACAAACAGACCAAAUUU...............................................................................  1         0.0201
..........................................................UUUGCUCUUUUUGUUUGUUUGCU........................................  1         0.0159
....................................................................................GUGUUUUGAGACAGGGU....................  3         0.0844
CCUUCCAAACAGUAAAAACAAACAAACAAACAGACCAAAUUUGUCAUUGUUGUUUCGAUUUGCUCUUUUUGUUUGUUUGCUUUUGUGUUUUGAGACAGGGUCUGGCUUGUAUAGCUCAUGC
(((((((((((.(((((.((((((((((((.(((.((((((...((....))....)))))).))).)))))))))))).))))))).)))).)).)))....((((.....))))..... (-31.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000032 3testes GEO : GSM510436 [ Chiang HR et al.]
ER0000000033 7testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 4testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000035 1testes GEO : GSM510439 [ Chiang HR et al.]
ER0000000037 1brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000040 3brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000045 3whole body GEO : GSM510449 Newborn. [ Chiang HR et al.]
ER0000000049 1whole body GEO : GSM510453 Newborn. [ Chiang HR et al.]
ER0000000050 1whole body GEO : GSM510454 Newborn. [ Chiang HR et al.]
ER0000000052 3whole body GEO : GSM510456 Newborn. [ Chiang HR et al.]
ER0000000061 1embryo GEO : GSM510465 day 7.5 embryo [ Chiang HR et al.]
ER0000000063 1embryo GEO : GSM510467 day 7.5 embryo [ Chiang HR et al.]
ER0000000221 1spleen GEO : GSM539840 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000222 1spleen GEO : GSM539841 strain: C57BL/6J, gender: male, isolation: CD43 negative magnetic beads selection
ER0000000240 1spleen GEO : GSM539859 strain: C57BL/6J, gender: male
ER0000000248 1 GEO : GSM539867 strain: C57BL/6J, developmental stage: E13.5
ER0000000254 1pancreas GEO : GSM539873 strain: C57BL/6J, gender: male
ER0000000258 2testes GEO : GSM539877 strain: C57BL/6J, gender: male
ER0000000261 1lymph nodes GEO : GSM539880 strain: BclXL transgenic BalbC, gender: male
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).