Deep sequencing reads for stem-loop sequence MI0005537

Stem-loop ID hsa-mir-888
Reads 
         hsa-miR-888-5p                     hsa-miR-888-3p                     Count     RPM (mean number of reads per million)
GGCAGUGCUCUACUCAAAAAGCUGUCAGUCACUUAGAUUACAUGUGACUGACACCUCUUUGGGUGAAGGAAGGCUCA
(((..(.((.((((((((.((.((((((((((...........)))))))))).)).)))))))).)).)..))).. (-31.90)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000142 1squamous cell GEO : GSM532878 [ Witten D et al.]
ER0000000172 1squamous cell GEO : GSM532908 [ Witten D et al.]
ER0000000174 1squamous cell GEO : GSM532910 [ Witten D et al.]
ER0000000189 1whole body GEO : GSM532925 normal cervix [ Witten D et al.]
ER0000000190 1squamous cell GEO : GSM532926 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).