Deep sequencing reads for stem-loop sequence MI0004706

Stem-loop IDmmu-mir-505
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                   mmu-miR-505-5p                     mmu-miR-505-3p                        Count     RPM (mean number of reads per million)
...................GGGAGCCAGGAAGUAUUGAUGUU................................................  1731      5.92
...................GGGAGCCAGGAAGUAUUGAUGU.................................................  777       3.65
...................GGGAGCCAGGAAGUAUUGAUGUUU...............................................  517       1.94
...................GGGAGCCAGGAAGUAUUGAUG..................................................  114       0.417
...................GGGAGCCAGGAAGUAUUGAU...................................................  88        0.413
...................GGGAGCCAGGAAGUAUUGAUGUUUC..............................................  54        0.182
...................GGGAGCCAGGAAGUAUUGA....................................................  16        0.039
...................GGGAGCCAGGAAGUAUUGAUGUUUCU.............................................  12        0.0321
....................GGAGCCAGGAAGUAUUGAUGUU................................................  4         0.0104
....................GGAGCCAGGAAGUAUUGAUGUUU...............................................  3         0.023
....................GGAGCCAGGAAGUAUUGAUGU.................................................  2         0.00562
....................GGAGCCAGGAAGUAUUGAU...................................................  1         0.00203
.....................GAGCCAGGAAGUAUUGAUGU.................................................  1         0.00235
......................AGCCAGGAAGUAUUGAUGUUU...............................................  1         0.00233
.......................................................CGUCAACACUUGCUGGUUUUCUCU...........  49        0.451
.......................................................CGUCAACACUUGCUGGUUUUCU.............  48        0.382
.......................................................CGUCAACACUUGCUGGUUUUCUC............  39        0.265
.......................................................CGUCAACACUUGCUGGUUUUC..............  14        0.116
.......................................................CGUCAACACUUGCUGGU..................  2         0.0125
........................................................GUCAACACUUGCUGGUUUUCUCU...........  72        0.631
........................................................GUCAACACUUGCUGGUUUUCUC............  53        0.434
........................................................GUCAACACUUGCUGGUUUUCU.............  25        0.272
........................................................GUCAACACUUGCUGGUUUUC..............  7         0.0238
.........................................................UCAACACUUGCUGGUUUUCUCU...........  42        0.153
.........................................................UCAACACUUGCUGGUUUUCU.............  27        0.15
.........................................................UCAACACUUGCUGGUUUUCUC............  10        0.0522
.........................................................UCAACACUUGCUGGUUUUC..............  6         0.0293
.........................................................UCAACACUUGCUGGUUUU...............  1         0.00245
..........................................................CAACACUUGCUGGUUUUCUCU...........  1         0.00265
...........................................................AACACUUGCUGGUUUUCU.............  2         0.00444
...........................................................AACACUUGCUGGUUUUCUC............  2         0.00491
...........................................................AACACUUGCUGGUUUUCUCU...........  2         0.00476
............................................................ACACUUGCUGGUUUUCUCUC..........  1         0.00284
AAAUUGAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGGUUAGCGUCAACACUUGCUGGUUUUCUCUCUGGAGUAUCA
....((((((..((((.(((..((((((.((((.((((((((.((....))..)))))))).)))).))))))..))).)))).)))))) (-43.20)

Filter reads

by experiment
AccessionRead countTissueLinkCommentReference
ER0000000031 1OvaryGEO : GSM510435 [ Chiang HR et al.]
ER0000000033 1TestesGEO : GSM510437 [ Chiang HR et al.]
ER0000000034 2TestesGEO : GSM510438 [ Chiang HR et al.]
ER0000000036 3BrainGEO : GSM510440 [ Chiang HR et al.]
ER0000000037 14BrainGEO : GSM510441 [ Chiang HR et al.]
ER0000000038 24BrainGEO : GSM510442 [ Chiang HR et al.]
ER0000000039 5BrainGEO : GSM510443 [ Chiang HR et al.]
ER0000000040 124BrainGEO : GSM510444 [ Chiang HR et al.]
ER0000000042 7Whole bodyGEO : GSM510446Newborn[ Chiang HR et al.]
ER0000000043 9Whole bodyGEO : GSM510447Newborn[ Chiang HR et al.]
ER0000000044 1Whole bodyGEO : GSM510448Newborn[ Chiang HR et al.]
ER0000000045 5Whole bodyGEO : GSM510449Newborn[ Chiang HR et al.]
ER0000000046 17Whole bodyGEO : GSM510450Newborn[ Chiang HR et al.]
ER0000000047 15Whole bodyGEO : GSM510451Newborn[ Chiang HR et al.]
ER0000000048 8Whole bodyGEO : GSM510452Newborn[ Chiang HR et al.]
ER0000000049 18Whole bodyGEO : GSM510453Newborn[ Chiang HR et al.]
ER0000000050 17Whole bodyGEO : GSM510454Newborn[ Chiang HR et al.]
ER0000000051 19Whole bodyGEO : GSM510455Newborn[ Chiang HR et al.]
ER0000000052 176Whole bodyGEO : GSM510456Newborn[ Chiang HR et al.]
ER0000000053 4EmbryoGEO : GSM510457Day: 12.5[ Chiang HR et al.]
ER0000000054 21EmbryoGEO : GSM510458Day: 12.5[ Chiang HR et al.]
ER0000000055 31EmbryoGEO : GSM510459Day: 12.5[ Chiang HR et al.]
ER0000000056 5EmbryoGEO : GSM510460Day: 12.5[ Chiang HR et al.]
ER0000000057 3EmbryoGEO : GSM510461Day: 9.5[ Chiang HR et al.]
ER0000000058 9EmbryoGEO : GSM510462Day: 9.5[ Chiang HR et al.]
ER0000000059 19EmbryoGEO : GSM510463Day: 9.5[ Chiang HR et al.]
ER0000000060 1EmbryoGEO : GSM510464Day: 9.5[ Chiang HR et al.]
ER0000000061 2EmbryoGEO : GSM510465Day: 7.5[ Chiang HR et al.]
ER0000000062 10EmbryoGEO : GSM510466Day: 7.5[ Chiang HR et al.]
ER0000000063 17EmbryoGEO : GSM510467Day: 7.5[ Chiang HR et al.]
ER0000000216 128Bone marrowGEO : GSM539835Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000217 85Bone marrowGEO : GSM539836Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000218 151SpleenGEO : GSM539837Strain: C57BL/6J; Gender: male; Isolation: Fluorescence activated cell sorting
ER0000000219 62SpleenGEO : GSM539838Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000220 148SpleenGEO : GSM539839Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000221 36SpleenGEO : GSM539840Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000222 30SpleenGEO : GSM539841Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000223 32SpleenGEO : GSM539842Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000224 17SpleenGEO : GSM539843Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000225 47Peritoneal lavageGEO : GSM539844Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000226 6SpleenGEO : GSM539845Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000227 20Lymph nodesGEO : GSM539846Strain: C57BL/6J, Gender: Male, Isolation: Fluorescence activated cell sorting
ER0000000228 24Lymph nodesGEO : GSM539847Strain: IL-6 transgenic; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000229 58Bone marrowGEO : GSM539848Strain: C57BL/6J; Gender: Male
ER0000000230 83Bone marrowGEO : GSM539849Strain: C57BL/6J; Gender: Male
ER0000000231 293Bone marrowGEO : GSM539850Strain: C57BL/6J; Gender: Male
ER0000000232 121Peritoneal lavageGEO : GSM539851Strain: C57BL/6J; Gender: Male
ER0000000233 29Peritoneal lavageGEO : GSM539852Strain: C57BL/6J; Gender: Male
ER0000000234 91Bone marrowGEO : GSM539853Strain: C57BL/6J; Gender: Male
ER0000000235 19Bone marrowGEO : GSM539854Strain: C57BL/6J; Gender: Male
ER0000000236 133SpleenGEO : GSM539855Strain: RAG-/- ; Gender: Male
ER0000000237 90ThymusGEO : GSM539856
ER0000000238 51SpleenGEO : GSM539857Strain: C57BL/6J; Gender: Male
ER0000000239 46SpleenGEO : GSM539858Strain: C57BL/6J; Gender: Male
ER0000000240 77SpleenGEO : GSM539859Strain: C57BL/6J; Gender: Male
ER0000000241 82Lymph nodes/spleenGEO : GSM539860Strain: C57BL/6J; Gender: Male
ER0000000242 147Lymph nodes/spleenGEO : GSM539861Strain: C57BL/6J; Gender: Male
ER0000000243 74Lymph nodes/spleenGEO : GSM539862Strain: C57BL/6J, Gender: Male
ER0000000244 348SpleenGEO : GSM539863Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000245 132Lymph nodes/spleenGEO : GSM539864Strain: C57BL/6J; Gender: Male
ER0000000246 64Lymph nodes/spleenGEO : GSM539865Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000247 40GEO : GSM539866Strain: C57BL/6-129
ER0000000248 16GEO : GSM539867Strain: C57BL/6J; Developmental stage: E13.5
ER0000000249 5HeartGEO : GSM539868Strain: C57BL/6J; Gender: Male
ER0000000250 150BrainGEO : GSM539869Strain: C57BL/6J; Gender: Male
ER0000000251 37LungGEO : GSM539870Strain: C57BL/6J; Gender: Male
ER0000000252 35LiverGEO : GSM539871Strain: C57BL/6J; Gender: Male
ER0000000253 33KidneyGEO : GSM539872Strain: C57BL/6J; Gender: Male
ER0000000254 3PancreasGEO : GSM539873Strain: C57BL/6J; Gender: Male
ER0000000255 33SkinGEO : GSM539874Strain: C57BL/6J; Gender: Male
ER0000000256 25Skeletal muscleGEO : GSM539875Strain: C57BL/6J; Gender: Male
ER0000000257 24Salivary glandsGEO : GSM539876Strain: C57BL/6J; Gender: Male
ER0000000258 1TestesGEO : GSM539877Strain: C57BL/6J; Gender: Male
ER0000000259 26OvaryGEO : GSM539878Strain: C57BL/6J; Gender: Female
ER0000000260 27SpleenGEO : GSM539879Strain: BclXL transgenic BalbC; Gender: Male
ER0000000261 68Lymph nodesGEO : GSM539880Strain: BclXL transgenic BalbC; Gender: Male
ER0000000415 7NIH-3T3 cellGEO : GSM774079Cell cycle arrest: Contact inhibition; Cell cycle phase: Asynchronous; Cell type: Fibroblast
ER0000000416 2NIH-3T3 cellGEO : GSM774080Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000417 1NIH-3T3 cellGEO : GSM774081Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000490 35BrainGEO : GSM995310Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000491 83CerebellumGEO : GSM995311Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000492 10HeartGEO : GSM995312Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000493 2KidneyGEO : GSM995313Age: Adult; Gender: Male[ Meunier J et al.]
ER0000000510 1Sertoli cells GEO : GSM995330Age: Pool of individuals; Gender: Male[ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).