Deep sequencing reads for stem-loop sequence MI0004706

Stem-loop ID mmu-mir-505
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Reads
                   mmu-miR-505-5p                     mmu-miR-505-3p                        Count     RPM (mean number of reads per million)
...................GGGAGCCAGGAAGUAUUGAUGUU................................................  1731      5.92
...................GGGAGCCAGGAAGUAUUGAUGU.................................................  777       3.65
...................GGGAGCCAGGAAGUAUUGAUGUUU...............................................  517       1.94
...................GGGAGCCAGGAAGUAUUGAUG..................................................  114       0.417
...................GGGAGCCAGGAAGUAUUGAU...................................................  88        0.413
...................GGGAGCCAGGAAGUAUUGAUGUUUC..............................................  54        0.182
...................GGGAGCCAGGAAGUAUUGA....................................................  16        0.039
...................GGGAGCCAGGAAGUAUUGAUGUUUCU.............................................  12        0.0321
....................GGAGCCAGGAAGUAUUGAUGUU................................................  4         0.0104
....................GGAGCCAGGAAGUAUUGAUGUUU...............................................  3         0.023
....................GGAGCCAGGAAGUAUUGAUGU.................................................  2         0.00562
....................GGAGCCAGGAAGUAUUGAU...................................................  1         0.00203
.....................GAGCCAGGAAGUAUUGAUGU.................................................  1         0.00235
......................AGCCAGGAAGUAUUGAUGUUU...............................................  1         0.00233
.......................................................CGUCAACACUUGCUGGUUUUCUCU...........  49        0.451
.......................................................CGUCAACACUUGCUGGUUUUCU.............  48        0.382
.......................................................CGUCAACACUUGCUGGUUUUCUC............  39        0.265
.......................................................CGUCAACACUUGCUGGUUUUC..............  14        0.116
.......................................................CGUCAACACUUGCUGGU..................  2         0.0125
........................................................GUCAACACUUGCUGGUUUUCUCU...........  72        0.631
........................................................GUCAACACUUGCUGGUUUUCUC............  53        0.434
........................................................GUCAACACUUGCUGGUUUUCU.............  25        0.272
........................................................GUCAACACUUGCUGGUUUUC..............  7         0.0238
.........................................................UCAACACUUGCUGGUUUUCUCU...........  42        0.153
.........................................................UCAACACUUGCUGGUUUUCU.............  27        0.15
.........................................................UCAACACUUGCUGGUUUUCUC............  10        0.0522
.........................................................UCAACACUUGCUGGUUUUC..............  6         0.0293
.........................................................UCAACACUUGCUGGUUUU...............  1         0.00245
..........................................................CAACACUUGCUGGUUUUCUCU...........  1         0.00265
...........................................................AACACUUGCUGGUUUUCU.............  2         0.00444
...........................................................AACACUUGCUGGUUUUCUC............  2         0.00491
...........................................................AACACUUGCUGGUUUUCUCU...........  2         0.00476
............................................................ACACUUGCUGGUUUUCUCUC..........  1         0.00284
AAAUUGAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGGUUAGCGUCAACACUUGCUGGUUUUCUCUCUGGAGUAUCA
....((((((..((((.(((..((((((.((((.((((((((.((....))..)))))))).)))).))))))..))).)))).)))))) (-43.20)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000031 1Ovary GEO : GSM510435 [ Chiang HR et al.]
ER0000000033 1Testes GEO : GSM510437 [ Chiang HR et al.]
ER0000000034 2Testes GEO : GSM510438 [ Chiang HR et al.]
ER0000000036 3Brain GEO : GSM510440 [ Chiang HR et al.]
ER0000000037 14Brain GEO : GSM510441 [ Chiang HR et al.]
ER0000000038 24Brain GEO : GSM510442 [ Chiang HR et al.]
ER0000000039 5Brain GEO : GSM510443 [ Chiang HR et al.]
ER0000000040 124Brain GEO : GSM510444 [ Chiang HR et al.]
ER0000000042 7Whole body GEO : GSM510446 Newborn [ Chiang HR et al.]
ER0000000043 9Whole body GEO : GSM510447 Newborn [ Chiang HR et al.]
ER0000000044 1Whole body GEO : GSM510448 Newborn [ Chiang HR et al.]
ER0000000045 5Whole body GEO : GSM510449 Newborn [ Chiang HR et al.]
ER0000000046 17Whole body GEO : GSM510450 Newborn [ Chiang HR et al.]
ER0000000047 15Whole body GEO : GSM510451 Newborn [ Chiang HR et al.]
ER0000000048 8Whole body GEO : GSM510452 Newborn [ Chiang HR et al.]
ER0000000049 18Whole body GEO : GSM510453 Newborn [ Chiang HR et al.]
ER0000000050 17Whole body GEO : GSM510454 Newborn [ Chiang HR et al.]
ER0000000051 19Whole body GEO : GSM510455 Newborn [ Chiang HR et al.]
ER0000000052 176Whole body GEO : GSM510456 Newborn [ Chiang HR et al.]
ER0000000053 4Embryo GEO : GSM510457 Day: 12.5 [ Chiang HR et al.]
ER0000000054 21Embryo GEO : GSM510458 Day: 12.5 [ Chiang HR et al.]
ER0000000055 31Embryo GEO : GSM510459 Day: 12.5 [ Chiang HR et al.]
ER0000000056 5Embryo GEO : GSM510460 Day: 12.5 [ Chiang HR et al.]
ER0000000057 3Embryo GEO : GSM510461 Day: 9.5 [ Chiang HR et al.]
ER0000000058 9Embryo GEO : GSM510462 Day: 9.5 [ Chiang HR et al.]
ER0000000059 19Embryo GEO : GSM510463 Day: 9.5 [ Chiang HR et al.]
ER0000000060 1Embryo GEO : GSM510464 Day: 9.5 [ Chiang HR et al.]
ER0000000061 2Embryo GEO : GSM510465 Day: 7.5 [ Chiang HR et al.]
ER0000000062 10Embryo GEO : GSM510466 Day: 7.5 [ Chiang HR et al.]
ER0000000063 17Embryo GEO : GSM510467 Day: 7.5 [ Chiang HR et al.]
ER0000000216 128Bone marrow GEO : GSM539835 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000217 85Bone marrow GEO : GSM539836 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000218 151Spleen GEO : GSM539837 Strain: C57BL/6J; Gender: male; Isolation: Fluorescence activated cell sorting
ER0000000219 62Spleen GEO : GSM539838 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000220 148Spleen GEO : GSM539839 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000221 36Spleen GEO : GSM539840 Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000222 30Spleen GEO : GSM539841 Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000223 32Spleen GEO : GSM539842 Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000224 17Spleen GEO : GSM539843 Strain: C57BL/6J; Gender: Male; Isolation: CD43 negative magnetic beads selection
ER0000000225 47Peritoneal lavage GEO : GSM539844 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000226 6Spleen GEO : GSM539845 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000227 20Lymph nodes GEO : GSM539846 Strain: C57BL/6J, Gender: Male, Isolation: Fluorescence activated cell sorting
ER0000000228 24Lymph nodes GEO : GSM539847 Strain: IL-6 transgenic; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000229 58Bone marrow GEO : GSM539848 Strain: C57BL/6J; Gender: Male
ER0000000230 83Bone marrow GEO : GSM539849 Strain: C57BL/6J; Gender: Male
ER0000000231 293Bone marrow GEO : GSM539850 Strain: C57BL/6J; Gender: Male
ER0000000232 121Peritoneal lavage GEO : GSM539851 Strain: C57BL/6J; Gender: Male
ER0000000233 29Peritoneal lavage GEO : GSM539852 Strain: C57BL/6J; Gender: Male
ER0000000234 91Bone marrow GEO : GSM539853 Strain: C57BL/6J; Gender: Male
ER0000000235 19Bone marrow GEO : GSM539854 Strain: C57BL/6J; Gender: Male
ER0000000236 133Spleen GEO : GSM539855 Strain: RAG-/- ; Gender: Male
ER0000000237 90Thymus GEO : GSM539856
ER0000000238 51Spleen GEO : GSM539857 Strain: C57BL/6J; Gender: Male
ER0000000239 46Spleen GEO : GSM539858 Strain: C57BL/6J; Gender: Male
ER0000000240 77Spleen GEO : GSM539859 Strain: C57BL/6J; Gender: Male
ER0000000241 82Lymph nodes/spleen GEO : GSM539860 Strain: C57BL/6J; Gender: Male
ER0000000242 147Lymph nodes/spleen GEO : GSM539861 Strain: C57BL/6J; Gender: Male
ER0000000243 74Lymph nodes/spleen GEO : GSM539862 Strain: C57BL/6J, Gender: Male
ER0000000244 348Spleen GEO : GSM539863 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000245 132Lymph nodes/spleen GEO : GSM539864 Strain: C57BL/6J; Gender: Male
ER0000000246 64Lymph nodes/spleen GEO : GSM539865 Strain: C57BL/6J; Gender: Male; Isolation: Fluorescence activated cell sorting
ER0000000247 40 GEO : GSM539866 Strain: C57BL/6-129
ER0000000248 16 GEO : GSM539867 Strain: C57BL/6J; Developmental stage: E13.5
ER0000000249 5Heart GEO : GSM539868 Strain: C57BL/6J; Gender: Male
ER0000000250 150Brain GEO : GSM539869 Strain: C57BL/6J; Gender: Male
ER0000000251 37Lung GEO : GSM539870 Strain: C57BL/6J; Gender: Male
ER0000000252 35Liver GEO : GSM539871 Strain: C57BL/6J; Gender: Male
ER0000000253 33Kidney GEO : GSM539872 Strain: C57BL/6J; Gender: Male
ER0000000254 3Pancreas GEO : GSM539873 Strain: C57BL/6J; Gender: Male
ER0000000255 33Skin GEO : GSM539874 Strain: C57BL/6J; Gender: Male
ER0000000256 25Skeletal muscle GEO : GSM539875 Strain: C57BL/6J; Gender: Male
ER0000000257 24Salivary glands GEO : GSM539876 Strain: C57BL/6J; Gender: Male
ER0000000258 1Testes GEO : GSM539877 Strain: C57BL/6J; Gender: Male
ER0000000259 26Ovary GEO : GSM539878 Strain: C57BL/6J; Gender: Female
ER0000000260 27Spleen GEO : GSM539879 Strain: BclXL transgenic BalbC; Gender: Male
ER0000000261 68Lymph nodes GEO : GSM539880 Strain: BclXL transgenic BalbC; Gender: Male
ER0000000415 7NIH-3T3 cell GEO : GSM774079 Cell cycle arrest: Contact inhibition; Cell cycle phase: Asynchronous; Cell type: Fibroblast
ER0000000416 2NIH-3T3 cell GEO : GSM774080 Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000417 1NIH-3T3 cell GEO : GSM774081 Cell cycle arrest: Contact inhibition; Cell cycle phase: G0; Cell type: Fibroblast
ER0000000490 35Brain GEO : GSM995310 Age: Adult; Gender: Male [ Meunier J et al.]
ER0000000491 83Cerebellum GEO : GSM995311 Age: Adult; Gender: Male [ Meunier J et al.]
ER0000000492 10Heart GEO : GSM995312 Age: Adult; Gender: Male [ Meunier J et al.]
ER0000000493 2Kidney GEO : GSM995313 Age: Adult; Gender: Male [ Meunier J et al.]
ER0000000510 1Sertoli cells GEO : GSM995330 Age: Pool of individuals; Gender: Male [ Meunier J et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).