Deep sequencing reads for stem-loop sequence MI0003834

Stem-loop ID

hsa-mir-769

Reads

                             hsa-miR-769-5p                         hsa-miR-769-3p                                      Count     RPM (mean number of reads per million)
............................CUGAGACCUCUGGGUUCUGAGC....................................................................  2         0.05
.............................UGAGACCUCUGGGUUCUGAGCU...................................................................  173       8.04
.............................UGAGACCUCUGGGUUCUGAGC....................................................................  90        4.12
.............................UGAGACCUCUGGGUUCUGAG.....................................................................  10        0.248
.............................UGAGACCUCUGGGUUCUGAGCUG..................................................................  5         0.119
....................................................................CUGGGAUCUCCGGGGUCUUGGUU...........................  64        1.59
....................................................................CUGGGAUCUCCGGGGUCUUGG.............................  13        0.3
....................................................................CUGGGAUCUCCGGGGUCUUGGU............................  7         0.156
.....................................................................UGGGAUCUCCGGGGUCUUGGUU...........................  16        0.646
.....................................................................UGGGAUCUCCGGGGUCUUGGU............................  5         0.634
GCCUUGGUGCUGAUUCCUGGGCUCUGACCUGAGACCUCUGGGUUCUGAGCUGUGAUGUUGCUCUCGAGCUGGGAUCUCCGGGGUCUUGGUUCAGGGCCGGGGCCUCUGGGUUCCAAGC
..(((((.(((((..(((.((((((((.(..(((((((.(((.(((.((((.(((........))))))).))).))).)))))))..).)))))))).)))..))..))).))))). (-60.10)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000001	4	embryonic stem cell	GEO : GSM541796		[ Bar M et al.]
ER0000000002	34	embryonic stem cell	GEO : GSM541797		[ Bar M et al.]
ER0000000103	37	melanoblast	GEO : GSM458535		[ Stark MS et al.]
ER0000000104	2	melanocyte	GEO : GSM458536		[ Stark MS et al.]
ER0000000105	19		GEO : GSM458537	cell line: primary giant congental nevus	[ Stark MS et al.]
ER0000000106	4	melanoma	GEO : GSM458538	cell line: secondary acral melanoma	[ Stark MS et al.]
ER0000000107	10	melanoma	GEO : GSM458539	cell line: secondary mucosal melanoma	[ Stark MS et al.]
ER0000000108	76	melanoma	GEO : GSM458540	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000109	42	melanoma	GEO : GSM458541	cell line: primary uveal melanoma	[ Stark MS et al.]
ER0000000110	100	melanoma	GEO : GSM458542	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000111	87	melanoma	GEO : GSM458543	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000112	64	melanoma	GEO : GSM458544	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000113	25	melanoma	GEO : GSM458545	cell line: secondary cutaneous melanoma from a chronically sun-damaged body site	[ Stark MS et al.]
ER0000000114	74	melanoma	GEO : GSM458546	cell line: secondary cutaneous melanoma	[ Stark MS et al.]
ER0000000135	2		GEO : GSM532871	normal cervix	[ Witten D et al.]
ER0000000140	1	squamous cell	GEO : GSM532876		[ Witten D et al.]
ER0000000141	3		GEO : GSM532877	normal cervix	[ Witten D et al.]
ER0000000147	3		GEO : GSM532883	normal cervix	[ Witten D et al.]
ER0000000156	1	squamous cell	GEO : GSM532892		[ Witten D et al.]
ER0000000157	3		GEO : GSM532893	normal cervix	[ Witten D et al.]
ER0000000160	1	squamous cell	GEO : GSM532896		[ Witten D et al.]
ER0000000161	5		GEO : GSM532897	normal cervix	[ Witten D et al.]
ER0000000164	1	squamous cell	GEO : GSM532900		[ Witten D et al.]
ER0000000165	5		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000169	9		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000171	6		GEO : GSM532907	normal cervix	[ Witten D et al.]
ER0000000174	2	squamous cell	GEO : GSM532910		[ Witten D et al.]
ER0000000175	1		GEO : GSM532911	normal cervix	[ Witten D et al.]
ER0000000178	1	squamous cell	GEO : GSM532914		[ Witten D et al.]
ER0000000181	4		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000264	1		GEO : GSM368181	tissue: undifferentiated NPC	[ Zhu JY et al.]
ER0000000266	1		GEO : GSM368183	tissue: undifferentiated NPC	[ Zhu JY et al.]

References

1. PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2. PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).