Deep sequencing reads for stem-loop sequence MI0003815

Stem-loop ID hsa-mir-1301
Reads 
                                                  hsa-miR-1301                      Count     RPM (mean number of reads per million)
..........GGGUCGCUCUAGGCACCGCAGCA.................................................  2         0.0842
..........GGGUCGCUCUAGGCACCGCAGC..................................................  2         0.105
...........GGUCGCUCUAGGCACCGCAGCA.................................................  2         0.0846
...........GGUCGCUCUAGGCACCGCAGC..................................................  2         0.105
...............................................UUGCAGCUGCCUGGGAGUGACUU............  614       30.7
...............................................UUGCAGCUGCCUGGGAGUGACUUC...........  603       41.9
...............................................UUGCAGCUGCCUGGGAGUGACUUCA..........  493       20
...............................................UUGCAGCUGCCUGGGAGUGACU.............  317       15.1
...............................................UUGCAGCUGCCUGGGAGUGA...............  109       5.68
...............................................UUGCAGCUGCCUGGGAGUGAC..............  76        3.83
...............................................UUGCAGCUGCCUGGGAGUG................  5         12.4
...............................................UUGCAGCUGCCUGGGAGU.................  3         12.7
................................................UGCAGCUGCCUGGGAGUGACUUCA..........  83        3.33
................................................UGCAGCUGCCUGGGAGUGACUUC...........  69        2.76
................................................UGCAGCUGCCUGGGAGUGACUU............  31        1.4
................................................UGCAGCUGCCUGGGAGUGACU.............  24        1.05
................................................UGCAGCUGCCUGGGAGUGA...............  5         0.331
................................................UGCAGCUGCCUGGGAGUG................  1         12.6
..................................................CAGCUGCCUGGGAGUGACUUCA..........  49        2.27
GGAUUGUGGGGGGUCGCUCUAGGCACCGCAGCACUGUGCUGGGGAUGUUGCAGCUGCCUGGGAGUGACUUCACACAGUCCUC
((((((((.(((((((((((((((((.((((((((.......)).)))))).).))))).))))))))))).)))))))).. (-45.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000002 2embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 334melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 59melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 6 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 9melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 104melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 189melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 118melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 1065melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 307melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 605melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 201melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 489melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000176 2adenosquamous cell GEO : GSM532912 [ Witten D et al.]
ER0000000262 2 GEO : GSM337570 antibody: anti-Ago1 4B8
ER0000000263 2 GEO : GSM337571 antibody: anti-Ago2 11A9
ER0000000264 7 GEO : GSM368181 tissue: undifferentiated NPC [ Zhu JY et al.]
ER0000000266 4 GEO : GSM368183 tissue: undifferentiated NPC [ Zhu JY et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).
3
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).