Deep sequencing reads for stem-loop sequence MI0003682

Stem-loop ID

hsa-mir-658

Reads

                                                                hsa-miR-658                          Count     RPM (mean number of reads per million)
GCUCGGUUGCCGUGGUUGCGGGCCCUGCCCGCCCGCCAGCUCGCUGACAGCACGACUCAGGGCGGAGGGAAGUAGGUCCGUUGGUCGGUCGGGAACGAGG
.((((.((.((((.(..(((((((((.(((..(((((...(((.((....))))).....))))).))).))..)))))))....).).))).)))))). (-42.00)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000151	1		GEO : GSM532887	normal cervix	[ Witten D et al.]
ER0000000157	2		GEO : GSM532893	normal cervix	[ Witten D et al.]
ER0000000165	2		GEO : GSM532901	normal cervix	[ Witten D et al.]
ER0000000169	3		GEO : GSM532905	normal cervix	[ Witten D et al.]
ER0000000181	3		GEO : GSM532917	normal cervix	[ Witten D et al.]
ER0000000188	1	squamous cell	GEO : GSM532924		[ Witten D et al.]

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).