Deep sequencing reads for stem-loop sequence MI0003681

Stem-loop ID hsa-mir-657
Reads 
                                                               hsa-miR-657                         Count     RPM (mean number of reads per million)
............................UGGAGAAGCGUGGACCGGUCCGG...............................................  13        3.23
............................UGGAGAAGCGUGGACCGGUCCG................................................  4         1.01
GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCGGCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG
..............(((((((((((.((((((((.....(((....)))(((((((..((....))..))))))))))))))).)))..)))))))). (-47.80)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000113 2melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 17melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000156 1squamous cell GEO : GSM532892 [ Witten D et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).