Deep sequencing reads for stem-loop sequence MI0003625

Stem-loop ID

hsa-mir-612

Reads

                   hsa-miR-612                                                                       Count     RPM (mean number of reads per million)
UCCCAUCUGGACCCUGCUGGGCAGGGCUUCUGAGCUCCUUAGCACUAGCAGGAGGGGCUCCAGGGGCCCUCCCUCCAUGGCAGCCAGGACAGGACUCUCA
(((..(((((.((.((..(((.((((((((((((((((((.((....))..)))))))).)))))))))))))..)).))...)))))...)))...... (-51.00)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000140	1	squamous cell	GEO : GSM532876		[ Witten D et al.]
ER0000000186	1	squamous cell	GEO : GSM532922		[ Witten D et al.]

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).