Deep sequencing reads for stem-loop sequence MI0003615

Stem-loop ID

hsa-mir-602

Reads

                  hsa-miR-602                                                                      Count     RPM (mean number of reads per million)
UUCUCACCCCCGCCUGACACGGGCGACAGCUGCGGCCCGCUGUGUUCACUCGGGCCGAGUGCGUCUCCUGUCAGGCAAGGGAGAGCAGAGCCCCCCUG
..(((.(((..((((((((.(((.(((.(((.(((((((..((....)).))))))))))..))))))))))))))..))).)))............. (-49.50)

Filter reads

by experiment

Accession	Read count	Tissue	Link	Comment	Reference
ER0000000156	1	squamous cell	GEO : GSM532892		[ Witten D et al.]
ER0000000157	1		GEO : GSM532893	normal cervix	[ Witten D et al.]

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).