Deep sequencing reads for stem-loop sequence MI0003608

Stem-loop ID hsa-mir-596
Reads 
                 hsa-miR-596                                                  Count     RPM (mean number of reads per million)
AGCACGGCCUCUCCGAAGCCUGCCCGGCUCCUCGGGAACCUGCCUCCCGCAUGGCAGCUGCUGCCCUUCGGAGGCCG
....(((((..(((((((...((.(((((((.(((((.......)))))...)).)))))..)).)))))))))))) (-36.50)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 2embryonic stem cell GEO : GSM541796 [ Bar M et al.]
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).