Deep sequencing reads for stem-loop sequence MI0003599

Stem-loop ID hsa-mir-589
Reads 
                       hsa-miR-589-5p                        hsa-miR-589-3p                           Count     RPM (mean number of reads per million)
....................CCCUGAGAACCACGUCUGCUCUGA.......................................................  3         37.4
.......................UGAGAACCACGUCUGCUCUGA.......................................................  320       18.2
.......................UGAGAACCACGUCUGCUCUGAGC.....................................................  125       5.34
.......................UGAGAACCACGUCUGCUCUGAG......................................................  30        1.5
.......................UGAGAACCACGUCUGCUCUG........................................................  3         0.546
........................GAGAACCACGUCUGCUCUGA.......................................................  2         0.0901
............................................................UCAGAACAAAUGCCGGUUCCCAGA...............  50        2.8
............................................................UCAGAACAAAUGCCGGUUCCCA.................  47        1.86
............................................................UCAGAACAAAUGCCGGUUCCCAG................  25        1.43
..............................................................AGAACAAAUGCCGGUUCCCAGA...............  7         0.21
..............................................................AGAACAAAUGCCGGUUCC...................  1         0.466
UCCAGCCUGUGCCCAGCAGCCCCUGAGAACCACGUCUGCUCUGAGCUGGGUACUGCCUGUUCAGAACAAAUGCCGGUUCCCAGACGCUGCCAGCUGGCC
....(((...((...(((((..(((.(((((.(((.((.(((((((.(((.....)))))))))).)).)))..))))).)))..)))))..)).))). (-41.40)

Filter reads

by experiment
Accession Read count Tissue Link Comment Reference
ER0000000001 8embryonic stem cell GEO : GSM541796 [ Bar M et al.]
ER0000000002 22embryonic stem cell GEO : GSM541797 [ Bar M et al.]
ER0000000103 88melanoblast GEO : GSM458535 [ Stark MS et al.]
ER0000000104 6melanocyte GEO : GSM458536 [ Stark MS et al.]
ER0000000105 21 GEO : GSM458537 cell line: primary giant congental nevus [ Stark MS et al.]
ER0000000106 7melanoma GEO : GSM458538 cell line: secondary acral melanoma [ Stark MS et al.]
ER0000000107 45melanoma GEO : GSM458539 cell line: secondary mucosal melanoma [ Stark MS et al.]
ER0000000108 64melanoma GEO : GSM458540 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000109 19melanoma GEO : GSM458541 cell line: primary uveal melanoma [ Stark MS et al.]
ER0000000110 238melanoma GEO : GSM458542 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000111 64melanoma GEO : GSM458543 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000112 48melanoma GEO : GSM458544 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000113 63melanoma GEO : GSM458545 cell line: secondary cutaneous melanoma from a chronically sun-damaged body site [ Stark MS et al.]
ER0000000114 42melanoma GEO : GSM458546 cell line: secondary cutaneous melanoma [ Stark MS et al.]
ER0000000147 1 GEO : GSM532883 normal cervix [ Witten D et al.]
ER0000000161 1 GEO : GSM532897 normal cervix [ Witten D et al.]
ER0000000165 1 GEO : GSM532901 normal cervix [ Witten D et al.]
ER0000000169 1 GEO : GSM532905 normal cervix [ Witten D et al.]
ER0000000262 1 GEO : GSM337570 antibody: anti-Ago1 4B8
by # mismatches     Display untemplated ends
by read count min max

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).